BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAZ1h07.yg.2.1
(357 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN820496.1|CN820496 HRO4413_A07_A13ZS5 Lib AA069E1X Aven... 46 2e-005
gb|CN820755.1|CN820755 HRO4414_D03_G06ZS5 Lib AA069E1X Aven... 32 0.32
>gb|CN820496.1|CN820496 HRO4413_A07_A13ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4413_A07_A13, mRNA
sequence
Length = 642
Score = 46.1 bits (23), Expect = 2e-005
Identities = 56/69 (81%)
Strand = Plus / Plus
Query: 243 ggaggccaactctgggtggtggatgccgatgcgnnagtcgtggggatnnnnctggaggat 302
|||||||||||| ||| |||| ||||||||| |||| ||||| | |||||||||
Sbjct: 63 ggaggccaactcgcggtcgtgggcgccgatgcgcgagtcctgggggtccatctggaggat 122
Query: 303 ggactccaa 311
|||||||||
Sbjct: 123 ggactccaa 131
>gb|CN820755.1|CN820755 HRO4414_D03_G06ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4414_D03_G06, mRNA
sequence
Length = 708
Score = 32.2 bits (16), Expect = 0.32
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 300 gatggactccaagcgc 315
||||||||||||||||
Sbjct: 446 gatggactccaagcgc 431
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 353
Number of Sequences: 8143
Number of extensions: 353
Number of successful extensions: 101
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99
Number of HSP's gapped (non-prelim): 2
length of query: 357
length of database: 4,702,463
effective HSP length: 15
effective length of query: 342
effective length of database: 4,580,318
effective search space: 1566468756
effective search space used: 1566468756
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)