BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAE20c02.yg.2.1
(696 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN820950.1|CN820950 HRO4421_G11_M21ZS5 Lib AA069E1X Aven... 157 2e-038
gb|CN815884.1|CN815884 HRO4511_E10_J19ZS5 Lib AA071E1X Aven... 98 1e-020
gb|CN821160.1|CN821160 HRO4428_B09_D18ZS5 Lib AA069E1X Aven... 44 2e-004
gb|AF118559.1|AF118559 Avena fatua puroindoline precursor, ... 38 0.010
>gb|CN820950.1|CN820950 HRO4421_G11_M21ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4421_G11_M21, mRNA
sequence
Length = 840
Score = 157 bits (79), Expect = 2e-038
Identities = 190/227 (83%)
Strand = Plus / Minus
Query: 204 tattgattgatcccgaaatagtctgatgagcccttgactagcttggcctgttcaggtgtg 263
||||| |||||||| | |||||||| |||||| ||||| || || || || ||||| |||
Sbjct: 244 tattggttgatcccaatatagtctgctgagcctttgaccagtttagcttgatcaggagtg 185
Query: 264 aaacttggtagccggtctttcacaatgtcttgcattatctttggatattgcccatttatt 323
|| || || | || |||||||||| |||||||||||| | ||| || || |||||||||
Sbjct: 184 aacctgggcaacctctctttcacaaggtcttgcattatttgtgggtaatgtccatttatt 125
Query: 324 aatggatcaagaaaccaaccaatatggaagtccctggccctttgcgctgctttttgatct 383
| |||||||| ||||||||||||||||||||| ||||| ||||| ||||| ||| |||
Sbjct: 124 agtggatcaacaaaccaaccaatatggaagtctctggctctttgtgctgcagcttggtct 65
Query: 384 tcagttgagtttgtaaaaggttcataccagttgaagtcaagaactat 430
|||||||||||||||| || |||||||| |||||||| ||||||||
Sbjct: 64 tcagttgagtttgtaagagcctcataccaattgaagtccagaactat 18
>gb|CN815884.1|CN815884 HRO4511_E10_J19ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4511_E10_J19, mRNA sequence
Length = 707
Score = 97.6 bits (49), Expect = 1e-020
Identities = 124/149 (83%)
Strand = Plus / Minus
Query: 204 tattgattgatcccgaaatagtctgatgagcccttgactagcttggcctgttcaggtgtg 263
||||| |||||||| | |||||||| |||||| ||||| || || || || ||||| |||
Sbjct: 159 tattggttgatcccaatatagtctgctgagcctttgaccagtttagcttgatcaggagtg 100
Query: 264 aaacttggtagccggtctttcacaatgtcttgcattatctttggatattgcccatttatt 323
|| || || | || |||||||||| |||||||||||| | ||| || || |||||||||
Sbjct: 99 aacctgggcaacctctctttcacaaggtcttgcattatttgtgggtaatgtccatttatt 40
Query: 324 aatggatcaagaaaccaaccaatatggaa 352
| |||||||| ||||||||||||||||||
Sbjct: 39 agtggatcaacaaaccaaccaatatggaa 11
>gb|CN821160.1|CN821160 HRO4428_B09_D18ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4428_B09_D18, mRNA
sequence
Length = 678
Score = 44.1 bits (22), Expect = 2e-004
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 204 tattgattgatcccgaaatagtctgatgagccct 237
|||||||||||||| | |||||||| ||||||||
Sbjct: 41 tattgattgatcccaatatagtctgctgagccct 8
>gb|AF118559.1|AF118559 Avena fatua puroindoline precursor, mRNA, complete cds
Length = 571
Score = 38.2 bits (19), Expect = 0.010
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggta 19
|||||||||||||||||||
Sbjct: 5 gcggccgcccgggcaggta 23
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1249
Number of Sequences: 8143
Number of extensions: 1249
Number of successful extensions: 337
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 330
Number of HSP's gapped (non-prelim): 7
length of query: 696
length of database: 4,702,463
effective HSP length: 16
effective length of query: 680
effective length of database: 4,572,175
effective search space: 3109079000
effective search space used: 3109079000
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)