BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 4790360.2.1
         (667 letters)

Database: Avena_nucl_with_EST.fasta 
           8143 sequences; 4,702,463 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CN819886.1|CN819886  HRO4407_C12_F23ZS5 Lib AA069E1X Aven...    36   0.038
gb|CN820381.1|CN820381  HRO4418_G01_M02ZS5 Lib AA069E1X Aven...    34   0.15 
>gb|CN819886.1|CN819886 HRO4407_C12_F23ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
           leaf Avena sativa cDNA clone HRO4407_C12_F23, mRNA
           sequence
          Length = 745

 Score = 36.2 bits (18), Expect = 0.038
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 428 tggagtattcatttgattcatc 449
           |||||||||||| |||||||||
Sbjct: 250 tggagtattcatatgattcatc 229
>gb|CN820381.1|CN820381 HRO4418_G01_M02ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
           leaf Avena sativa cDNA clone HRO4418_G01_M02, mRNA
           sequence
          Length = 474

 Score = 34.2 bits (17), Expect = 0.15
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 61  ttatgctttatcagctg 77
           |||||||||||||||||
Sbjct: 418 ttatgctttatcagctg 434
  Database: Avena_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:15 PM
  Number of letters in database: 4,702,463
  Number of sequences in database:  8143
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1630
Number of Sequences: 8143
Number of extensions: 1630
Number of successful extensions: 458
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 456
Number of HSP's gapped (non-prelim): 2
length of query: 667
length of database: 4,702,463
effective HSP length: 16
effective length of query: 651
effective length of database: 4,572,175
effective search space: 2976485925
effective search space used: 2976485925
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)