BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3748535.2.1
(619 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN814661.1|CN814661 HRO4501_B06_C11ZS5 Lib AA071E1X Aven... 72 6e-013
>gb|CN814661.1|CN814661 HRO4501_B06_C11ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4501_B06_C11, mRNA sequence
Length = 842
Score = 71.9 bits (36), Expect = 6e-013
Identities = 102/124 (82%)
Strand = Plus / Plus
Query: 332 atgaaggttttggatgtgggatgtggaattgggggacctttaatagaaatcgccagattc 391
|||||||||||||| ||||| |||||||| || ||||| |||| ||| || ||||||||
Sbjct: 230 atgaaggttttggacgtgggctgtggaataggtggaccattaagagagattgccagattt 289
Query: 392 agctcaacatcgataactggactgaacaacaatgactaccacatctcaaggggcaaggag 451
|||||||| || | || ||| |||||||||| ||||| || || | ||||| ||||||
Sbjct: 290 agctcaacctcagttaccggattgaacaacaacgactatcagataactaggggaaaggag 349
Query: 452 ctca 455
||||
Sbjct: 350 ctca 353
Score = 36.2 bits (18), Expect = 0.036
Identities = 42/50 (84%)
Strand = Plus / Plus
Query: 524 gataacacctttgatgcggcctatgcaatacaggctacatgtcatgcacc 573
|||||||| |||||||| | ||||| || |||| ||||||||||||||
Sbjct: 422 gataacacttttgatgctgtttatgccattgaggcaacatgtcatgcacc 471
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1839
Number of Sequences: 8143
Number of extensions: 1839
Number of successful extensions: 509
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 507
Number of HSP's gapped (non-prelim): 2
length of query: 619
length of database: 4,702,463
effective HSP length: 16
effective length of query: 603
effective length of database: 4,572,175
effective search space: 2757021525
effective search space used: 2757021525
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)