BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3748535.2.1
         (619 letters)

Database: Avena_nucl_with_EST.fasta 
           8143 sequences; 4,702,463 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CN814661.1|CN814661  HRO4501_B06_C11ZS5 Lib AA071E1X Aven...    72   6e-013
>gb|CN814661.1|CN814661 HRO4501_B06_C11ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
           sativa cDNA clone HRO4501_B06_C11, mRNA sequence
          Length = 842

 Score = 71.9 bits (36), Expect = 6e-013
 Identities = 102/124 (82%)
 Strand = Plus / Plus

                                                                       
Query: 332 atgaaggttttggatgtgggatgtggaattgggggacctttaatagaaatcgccagattc 391
           |||||||||||||| ||||| |||||||| || ||||| |||| ||| || |||||||| 
Sbjct: 230 atgaaggttttggacgtgggctgtggaataggtggaccattaagagagattgccagattt 289

                                                                       
Query: 392 agctcaacatcgataactggactgaacaacaatgactaccacatctcaaggggcaaggag 451
           |||||||| ||  | || ||| |||||||||| ||||| || ||  | ||||| ||||||
Sbjct: 290 agctcaacctcagttaccggattgaacaacaacgactatcagataactaggggaaaggag 349

               
Query: 452 ctca 455
           ||||
Sbjct: 350 ctca 353

 Score = 36.2 bits (18), Expect = 0.036
 Identities = 42/50 (84%)
 Strand = Plus / Plus

                                                             
Query: 524 gataacacctttgatgcggcctatgcaatacaggctacatgtcatgcacc 573
           |||||||| |||||||| |  ||||| ||  |||| ||||||||||||||
Sbjct: 422 gataacacttttgatgctgtttatgccattgaggcaacatgtcatgcacc 471
  Database: Avena_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:15 PM
  Number of letters in database: 4,702,463
  Number of sequences in database:  8143
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1839
Number of Sequences: 8143
Number of extensions: 1839
Number of successful extensions: 509
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 507
Number of HSP's gapped (non-prelim): 2
length of query: 619
length of database: 4,702,463
effective HSP length: 16
effective length of query: 603
effective length of database: 4,572,175
effective search space: 2757021525
effective search space used: 2757021525
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)