BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3742446.2.1
(598 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|X78433.1|ASLBDG A.sativa L. mRNA for beta-D-glucosidase 50 2e-006
gb|CN820950.1|CN820950 HRO4421_G11_M21ZS5 Lib AA069E1X Aven... 38 0.009
gb|CN821544.1|CN821544 HRO4426_E05_I10ZS5 Lib AA069E1X Aven... 36 0.034
gb|CN821554.1|CN821554 HRO4426_F05_K10ZS5 Lib AA069E1X Aven... 36 0.034
>emb|X78433.1|ASLBDG A.sativa L. mRNA for beta-D-glucosidase
Length = 1898
Score = 50.1 bits (25), Expect = 2e-006
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 125 ttcggagacagggtgaagaactggtttaccttcaacgagcc 165
||||| |||| ||||||||||||||| ||||| ||||||||
Sbjct: 679 ttcggcgacaaggtgaagaactggttcacctttaacgagcc 719
>gb|CN820950.1|CN820950 HRO4421_G11_M21ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4421_G11_M21, mRNA
sequence
Length = 840
Score = 38.2 bits (19), Expect = 0.009
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 401 gaccaggctgcagcacagcgagccagggacttcca 435
||||| ||||||||||| ||||||| ||||||||
Sbjct: 66 gaccaagctgcagcacaaagagccagagacttcca 100
>gb|CN821544.1|CN821544 HRO4426_E05_I10ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4426_E05_I10, mRNA
sequence
Length = 668
Score = 36.2 bits (18), Expect = 0.034
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 336 agaaggggaagattggaa 353
||||||||||||||||||
Sbjct: 474 agaaggggaagattggaa 491
>gb|CN821554.1|CN821554 HRO4426_F05_K10ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4426_F05_K10, mRNA
sequence
Length = 865
Score = 36.2 bits (18), Expect = 0.034
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 336 agaaggggaagattggaa 353
||||||||||||||||||
Sbjct: 473 agaaggggaagattggaa 490
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1211
Number of Sequences: 8143
Number of extensions: 1211
Number of successful extensions: 320
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 315
Number of HSP's gapped (non-prelim): 5
length of query: 598
length of database: 4,702,463
effective HSP length: 16
effective length of query: 582
effective length of database: 4,572,175
effective search space: 2661005850
effective search space used: 2661005850
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)