BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3713074.2.1
         (527 letters)

Database: Avena_nucl_with_EST.fasta 
           8143 sequences; 4,702,463 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CN815397.1|CN815397  HRO4509_B12_C23ZS5 Lib AA071E1X Aven...    32   0.47 
gb|CN819494.1|CN819494  HRO4406_G06_M12ZS5 Lib AA069E1X Aven...    32   0.47 
>gb|CN815397.1|CN815397 HRO4509_B12_C23ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
           sativa cDNA clone HRO4509_B12_C23, mRNA sequence
          Length = 859

 Score = 32.2 bits (16), Expect = 0.47
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                           
Query: 181 gcgcagatcatccagg 196
           ||||||||||||||||
Sbjct: 494 gcgcagatcatccagg 509
>gb|CN819494.1|CN819494 HRO4406_G06_M12ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
           leaf Avena sativa cDNA clone HRO4406_G06_M12, mRNA
           sequence
          Length = 413

 Score = 32.2 bits (16), Expect = 0.47
 Identities = 19/20 (95%)
 Strand = Plus / Minus

                               
Query: 345 gttttgaccttggtaacgat 364
           |||||||| |||||||||||
Sbjct: 88  gttttgacattggtaacgat 69
  Database: Avena_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:15 PM
  Number of letters in database: 4,702,463
  Number of sequences in database:  8143
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1192
Number of Sequences: 8143
Number of extensions: 1192
Number of successful extensions: 303
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 301
Number of HSP's gapped (non-prelim): 2
length of query: 527
length of database: 4,702,463
effective HSP length: 16
effective length of query: 511
effective length of database: 4,572,175
effective search space: 2336381425
effective search space used: 2336381425
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)