BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3665525.2.1
(620 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN815040.1|CN815040 HRO4505_B12_C23ZS5 Lib AA071E1X Aven... 38 0.009
gb|CN820381.1|CN820381 HRO4418_G01_M02ZS5 Lib AA069E1X Aven... 34 0.14
>gb|CN815040.1|CN815040 HRO4505_B12_C23ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4505_B12_C23, mRNA sequence
Length = 774
Score = 38.2 bits (19), Expect = 0.009
Identities = 46/55 (83%)
Strand = Plus / Minus
Query: 564 tcataccatttcaacttaggatcagtaaaaacaggccccttcttcatgcatccaa 618
||||||||||||| || |||||| | | ||| || |||||||||||||| ||||
Sbjct: 90 tcataccatttcatatttggatcactgacaactggtcccttcttcatgcaaccaa 36
>gb|CN820381.1|CN820381 HRO4418_G01_M02ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4418_G01_M02, mRNA
sequence
Length = 474
Score = 34.2 bits (17), Expect = 0.14
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 493 cagctgataaagcataa 509
|||||||||||||||||
Sbjct: 434 cagctgataaagcataa 418
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1348
Number of Sequences: 8143
Number of extensions: 1348
Number of successful extensions: 401
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 399
Number of HSP's gapped (non-prelim): 2
length of query: 620
length of database: 4,702,463
effective HSP length: 16
effective length of query: 604
effective length of database: 4,572,175
effective search space: 2761593700
effective search space used: 2761593700
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)