BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3562100.2.1
(759 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN820087.1|CN820087 HRO4410_H10_O20ZS5 Lib AA069E1X Aven... 86 5e-017
emb|AJ437568.1|AST437568 Avena strigosa partial rga gene fo... 34 0.17
emb|AJ437569.1|AST437569 Avena strigosa partial rga gene fo... 34 0.17
emb|AJ619773.1| Avena strigosa partial rga gene for NBS-LRR... 34 0.17
emb|AJ619774.1| Avena strigosa partial rga gene for NBS-LRR... 34 0.17
>gb|CN820087.1|CN820087 HRO4410_H10_O20ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4410_H10_O20, mRNA
sequence
Length = 657
Score = 85.7 bits (43), Expect = 5e-017
Identities = 64/71 (90%)
Strand = Plus / Plus
Query: 126 cttcagacagacaaaggtgatgaagaattgtgtagtgtttatgtgccaaccaatcattta 185
||||||||||||||||| || |||||| | |||||||||||||||||||| ||||| ||
Sbjct: 34 cttcagacagacaaaggcgacgaagaactctgtagtgtttatgtgccaacaaatcaccta 93
Query: 186 tatattggtga 196
|||||||||||
Sbjct: 94 tatattggtga 104
Score = 40.1 bits (20), Expect = 0.003
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 243 attcgtgaaggcatagaaataattgtttcaggaggaatgactatgccgcaggtgat 298
||||| ||||| || ||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 151 attcgagaaggaattgaaattatcgtgtctggaggaatgaccatgccacaggtgat 206
>emb|AJ437568.1|AST437568 Avena strigosa partial rga gene for putative resistance protein,
clone L7M2GG5.1
Length = 539
Score = 34.2 bits (17), Expect = 0.17
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 80 ccgtgttggtgaatatg 96
|||||||||||||||||
Sbjct: 239 ccgtgttggtgaatatg 255
>emb|AJ437569.1|AST437569 Avena strigosa partial rga gene for putative resistance protein,
clone L7M2GG5.2
Length = 539
Score = 34.2 bits (17), Expect = 0.17
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 80 ccgtgttggtgaatatg 96
|||||||||||||||||
Sbjct: 239 ccgtgttggtgaatatg 255
>emb|AJ619773.1| Avena strigosa partial rga gene for NBS-LRR-like resistance protein
1
Length = 539
Score = 34.2 bits (17), Expect = 0.17
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 80 ccgtgttggtgaatatg 96
|||||||||||||||||
Sbjct: 239 ccgtgttggtgaatatg 255
>emb|AJ619774.1| Avena strigosa partial rga gene for NBS-LRR-like resistance protein
2
Length = 539
Score = 34.2 bits (17), Expect = 0.17
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 80 ccgtgttggtgaatatg 96
|||||||||||||||||
Sbjct: 239 ccgtgttggtgaatatg 255
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1840
Number of Sequences: 8143
Number of extensions: 1840
Number of successful extensions: 506
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 500
Number of HSP's gapped (non-prelim): 6
length of query: 759
length of database: 4,702,463
effective HSP length: 16
effective length of query: 743
effective length of database: 4,572,175
effective search space: 3397126025
effective search space used: 3397126025
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)