BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3204272.2.1
(739 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN815151.1|CN815151 HRO4506_D10_G20ZS5 Lib AA071E1X Aven... 135 6e-032
gb|CN818949.1|CN818949 HRO4474_G09_N18ZS5 Lib AA070E1X Aven... 119 4e-027
>gb|CN815151.1|CN815151 HRO4506_D10_G20ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4506_D10_G20, mRNA sequence
Length = 599
Score = 135 bits (68), Expect = 6e-032
Identities = 184/220 (83%), Gaps = 2/220 (0%)
Strand = Plus / Minus
Query: 192 tcacatctccgctacaagcttggactgagccagggcgagatcgaacgagctgaaggagcg 251
|||||||||||| ||||||| ||||||||||| || || ||||||||| ||||||| |
Sbjct: 333 tcacatctccgcgacaagctgtgactgagccagcgcaaggtcgaacgaggagaaggagtg 274
Query: 252 aggagccagcgtgacctgcatctgctctgcagcattgctcagatcgctctttaccggcac 311
|| || || ||||||||||||||||| ||||| |||| ||| | ||| | || |||||
Sbjct: 273 agcagggagtgtgacctgcatctgctccgcagcgttgcgcagctggcttgtcacaggcac 214
Query: 312 aaccttggttgggttgctgaaggagttttcatccatcacatctgct-gatgtgagaacag 370
||||||| ||||||| |||||||| |||||||||||||||| |||| |||||||||||||
Sbjct: 213 aaccttgtttgggttactgaaggaattttcatccatcacat-tgctggatgtgagaacag 155
Query: 371 tggcggttgatcccagagcgttgatactggcctggagccc 410
| ||| | || || |||| |||||| || ||||| |||||
Sbjct: 154 tagcgttcgaccctagagtgttgatgctagcctgaagccc 115
>gb|CN818949.1|CN818949 HRO4474_G09_N18ZS5 Lib AA070E1X Avena sativa cv. Ogle-C green leaf
Avena sativa cDNA clone HRO4474_G09_N18, mRNA sequence
Length = 495
Score = 119 bits (60), Expect = 4e-027
Identities = 182/220 (82%), Gaps = 2/220 (0%)
Strand = Plus / Minus
Query: 192 tcacatctccgctacaagcttggactgagccagggcgagatcgaacgagctgaaggagcg 251
|||||||||||| ||||||| ||||||||||| || || ||||||||| ||||||| |
Sbjct: 299 tcacatctccgcgacaagctgtgactgagccagcgcaaggtcgaacgaggagaaggagtg 240
Query: 252 aggagccagcgtgacctgcatctgctctgcagcattgctcagatcgctctttaccggcac 311
|| || || ||||||||||||||||| ||||| |||| ||| | ||| | || |||||
Sbjct: 239 agcagggagtgtgacctgcatctgctccgcagcgttgcgcagctggcttgtcacaggcac 180
Query: 312 aaccttggttgggttgctgaaggagttttcatccatcacatctgct-gatgtgagaacag 370
||||||| | ||||| |||||||| |||||||||||||||| |||| || || |||||||
Sbjct: 179 aaccttgttcgggttactgaaggaattttcatccatcacat-tgctggacgtcagaacag 121
Query: 371 tggcggttgatcccagagcgttgatactggcctggagccc 410
| ||| | || ||||| |||||||| || ||||| |||||
Sbjct: 120 tagcgttcgaacccagcgcgttgatgctagcctgaagccc 81
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1721
Number of Sequences: 8143
Number of extensions: 1721
Number of successful extensions: 481
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 477
Number of HSP's gapped (non-prelim): 3
length of query: 739
length of database: 4,702,463
effective HSP length: 16
effective length of query: 723
effective length of database: 4,572,175
effective search space: 3305682525
effective search space used: 3305682525
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)