BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3203838.2.1
(534 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF118559.1|AF118559 Avena fatua puroindoline precursor, ... 46 3e-005
gb|CN814864.1|CN814864 HRO4503_C11_F21ZS5 Lib AA071E1X Aven... 36 0.031
gb|CN820854.1|CN820854 HRO4420_G01_N02ZS5 Lib AA069E1X Aven... 36 0.031
gb|CN815761.1|CN815761 HRO4510_C01_E02ZS5 Lib AA071E1X Aven... 34 0.12
gb|CN815915.1|CN815915 HRO4511_H05_P09ZS5 Lib AA071E1X Aven... 34 0.12
gb|AY277385.1| Avena sativa 1,3-beta glucanase (Oglc13) gen... 32 0.48
gb|AF155932.1| Avena sativa 1,3-beta glucanase (Oglc13) mRN... 32 0.48
>gb|AF118559.1|AF118559 Avena fatua puroindoline precursor, mRNA, complete cds
Length = 571
Score = 46.1 bits (23), Expect = 3e-005
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 511 tacctgcccgggcggccgctcga 533
|||||||||||||||||||||||
Sbjct: 23 tacctgcccgggcggccgctcga 1
>gb|CN814864.1|CN814864 HRO4503_C11_F21ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4503_C11_F21, mRNA sequence
Length = 547
Score = 36.2 bits (18), Expect = 0.031
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 233 tgccgatgtcgatgacga 250
||||||||||||||||||
Sbjct: 363 tgccgatgtcgatgacga 380
>gb|CN820854.1|CN820854 HRO4420_G01_N02ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4420_G01_N02, mRNA
sequence
Length = 379
Score = 36.2 bits (18), Expect = 0.031
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 233 tgccgatgtcgatgacga 250
||||||||||||||||||
Sbjct: 341 tgccgatgtcgatgacga 358
>gb|CN815761.1|CN815761 HRO4510_C01_E02ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4510_C01_E02, mRNA sequence
Length = 628
Score = 34.2 bits (17), Expect = 0.12
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 432 ggcagagatctgcagag 448
|||||||||||||||||
Sbjct: 200 ggcagagatctgcagag 216
>gb|CN815915.1|CN815915 HRO4511_H05_P09ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4511_H05_P09, mRNA sequence
Length = 842
Score = 34.2 bits (17), Expect = 0.12
Identities = 23/25 (92%)
Strand = Plus / Plus
Query: 351 gaagtccatcatctcctgcgtgtcc 375
||||| |||||||||||| ||||||
Sbjct: 388 gaagttcatcatctcctgggtgtcc 412
Score = 32.2 bits (16), Expect = 0.48
Identities = 25/28 (89%)
Strand = Plus / Plus
Query: 236 cgatgtcgatgacgaagcggtacctgac 263
|||||||||| || || |||||||||||
Sbjct: 273 cgatgtcgattacaaaccggtacctgac 300
>gb|AY277385.1| Avena sativa 1,3-beta glucanase (Oglc13) gene, complete cds
Length = 3281
Score = 32.2 bits (16), Expect = 0.48
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 231 gttgccgatgtcgatgacga 250
|||||||||||| |||||||
Sbjct: 2413 gttgccgatgtccatgacga 2394
>gb|AF155932.1| Avena sativa 1,3-beta glucanase (Oglc13) mRNA, partial cds
Length = 1045
Score = 32.2 bits (16), Expect = 0.48
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 231 gttgccgatgtcgatgacga 250
|||||||||||| |||||||
Sbjct: 168 gttgccgatgtccatgacga 149
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1073
Number of Sequences: 8143
Number of extensions: 1073
Number of successful extensions: 272
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 264
Number of HSP's gapped (non-prelim): 8
length of query: 534
length of database: 4,702,463
effective HSP length: 16
effective length of query: 518
effective length of database: 4,572,175
effective search space: 2368386650
effective search space used: 2368386650
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)