BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3191495.2.1
         (1277 letters)

Database: Avena_nucl_with_EST.fasta 
           8143 sequences; 4,702,463 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CN815081.1|CN815081  HRO4505_F08_K15ZS5 Lib AA071E1X Aven...    36   0.074
gb|CN816823.1|CN816823  HRO4525_C01_E01ZS5 Lib AA071E1X Aven...    36   0.074
gb|CN821219.1|CN821219  HRO4428_H01_P02ZS5 Lib AA069E1X Aven...    34   0.29 
>gb|CN815081.1|CN815081 HRO4505_F08_K15ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
            sativa cDNA clone HRO4505_F08_K15, mRNA sequence
          Length = 494

 Score = 36.2 bits (18), Expect = 0.074
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 1227 atagaatacatattttttatga 1248
            |||||| |||||||||||||||
Sbjct: 456  atagaaaacatattttttatga 477
>gb|CN816823.1|CN816823 HRO4525_C01_E01ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
            sativa cDNA clone HRO4525_C01_E01, mRNA sequence
          Length = 619

 Score = 36.2 bits (18), Expect = 0.074
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 1004 gtgtcatcctccttctcc 1021
            ||||||||||||||||||
Sbjct: 573  gtgtcatcctccttctcc 556
>gb|CN821219.1|CN821219 HRO4428_H01_P02ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
           leaf Avena sativa cDNA clone HRO4428_H01_P02, mRNA
           sequence
          Length = 576

 Score = 34.2 bits (17), Expect = 0.29
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 493 agaagctgcgcaaggcg 509
           |||||||||||||||||
Sbjct: 76  agaagctgcgcaaggcg 92
  Database: Avena_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:15 PM
  Number of letters in database: 4,702,463
  Number of sequences in database:  8143
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3376
Number of Sequences: 8143
Number of extensions: 3376
Number of successful extensions: 982
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 979
Number of HSP's gapped (non-prelim): 3
length of query: 1277
length of database: 4,702,463
effective HSP length: 16
effective length of query: 1261
effective length of database: 4,572,175
effective search space: 5765512675
effective search space used: 5765512675
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)