BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2762998.2.1
(1036 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN815601.1|CN815601 HRO4513_E02_I03ZS5 Lib AA071E1X Aven... 34 0.24
gb|CN818021.1|CN818021 HRO4472_E06_I12ZS5 Lib AA070E1X Aven... 34 0.24
>gb|CN815601.1|CN815601 HRO4513_E02_I03ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4513_E02_I03, mRNA sequence
Length = 453
Score = 34.2 bits (17), Expect = 0.24
Identities = 23/25 (92%)
Strand = Plus / Minus
Query: 298 gtcgagatggccttcattcagattg 322
||||||||| || ||||||||||||
Sbjct: 106 gtcgagatgaccgtcattcagattg 82
>gb|CN818021.1|CN818021 HRO4472_E06_I12ZS5 Lib AA070E1X Avena sativa cv. Ogle-C green leaf
Avena sativa cDNA clone HRO4472_E06_I12, mRNA sequence
Length = 658
Score = 34.2 bits (17), Expect = 0.24
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 279 caattaaccaaaagaac 295
|||||||||||||||||
Sbjct: 172 caattaaccaaaagaac 188
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2039
Number of Sequences: 8143
Number of extensions: 2039
Number of successful extensions: 570
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 568
Number of HSP's gapped (non-prelim): 2
length of query: 1036
length of database: 4,702,463
effective HSP length: 16
effective length of query: 1020
effective length of database: 4,572,175
effective search space: 4663618500
effective search space used: 4663618500
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)