BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2750422.2.1
(1599 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN821419.1|CN821419 HRO4425_B04_C07ZS5 Lib AA069E1X Aven... 139 9e-033
gb|AF118559.1|AF118559 Avena fatua puroindoline precursor, ... 46 1e-004
gb|CN818618.1|CN818618 HRO4467_C08_E15ZS5 Lib AA070E1X Aven... 34 0.37
>gb|CN821419.1|CN821419 HRO4425_B04_C07ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4425_B04_C07, mRNA
sequence
Length = 744
Score = 139 bits (70), Expect = 9e-033
Identities = 145/170 (85%)
Strand = Plus / Minus
Query: 606 ttgaactgcaccaggatcatggtcatgttgtcgcacccgtctccagcgatcgttgatgga 665
||||||||||| |||||||| ||||||||||| || || |||||| | | |||||||||
Sbjct: 180 ttgaactgcactaggatcattgtcatgttgtcacatccttctccacctaatgttgatgga 121
Query: 666 gccaggcatctgtccagcactctctcgcacacggcagacaggctgctctccgtgtttata 725
||||||||||| || ||||| | || ||||| ||||| ||||||||||| ||||||||
Sbjct: 120 gccaggcatctatcgagcaccttttcacacaccgcagaaaggctgctctctgtgtttatg 61
Query: 726 cgctcgtggataaaatccaccagctgttggcttgacatgcagtcccaaat 775
|||| |||| ||||| |||||||||||||| |||||||||||||||||
Sbjct: 60 tgctcatggacgaaatcgaccagctgttggctagacatgcagtcccaaat 11
>gb|AF118559.1|AF118559 Avena fatua puroindoline precursor, mRNA, complete cds
Length = 571
Score = 46.1 bits (23), Expect = 1e-004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1576 tacctgcccgggcggccgctcga 1598
|||||||||||||||||||||||
Sbjct: 23 tacctgcccgggcggccgctcga 1
>gb|CN818618.1|CN818618 HRO4467_C08_E15ZS5 Lib AA070E1X Avena sativa cv. Ogle-C green leaf
Avena sativa cDNA clone HRO4467_C08_E15, mRNA sequence
Length = 481
Score = 34.2 bits (17), Expect = 0.37
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 873 aatttgttctgtttcaa 889
|||||||||||||||||
Sbjct: 450 aatttgttctgtttcaa 466
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4212
Number of Sequences: 8143
Number of extensions: 4212
Number of successful extensions: 1002
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 998
Number of HSP's gapped (non-prelim): 4
length of query: 1599
length of database: 4,702,463
effective HSP length: 17
effective length of query: 1582
effective length of database: 4,564,032
effective search space: 7220298624
effective search space used: 7220298624
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)