BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2576612.2.1
(845 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN821219.1|CN821219 HRO4428_H01_P02ZS5 Lib AA069E1X Aven... 379 e-105
gb|CN816185.1|CN816185 HRO4517_H07_O13ZS5 Lib AA071E1X Aven... 180 1e-045
gb|CN819635.1|CN819635 HRO4402_D11_G22ZS5 Lib AA069E1X Aven... 157 2e-038
>gb|CN821219.1|CN821219 HRO4428_H01_P02ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4428_H01_P02, mRNA
sequence
Length = 576
Score = 379 bits (191), Expect = e-105
Identities = 284/315 (90%)
Strand = Plus / Plus
Query: 318 agaaggttccagaggggtttgaagaggaagcccatggcgctcatcaagaagctgcgcaag 377
||||||||| |||| ||| | ||||||||||||||||||||| |||||||||||||||||
Sbjct: 30 agaaggttcaagagaggtctcaagaggaagcccatggcgctcgtcaagaagctgcgcaag 89
Query: 378 gcgaaaaaggatgctcctgtcggcgagaagccagagccagtgaagacccatctccgcaac 437
|||||||||||||| |||| || |||||||| ||||| |||| ||| ||||||||||||
Sbjct: 90 gcgaaaaaggatgcccctgctggtgagaagcctgagcctgtgaggacacatctccgcaac 149
Query: 438 atgatcattgtccccgagatgattgggagcattgttggtgtctacaatggcaagaccttc 497
|||||||||||||| ||||||||||| ||| || | ||||||||||||||||||||||||
Sbjct: 150 atgatcattgtccctgagatgattggcagccttatcggtgtctacaatggcaagaccttc 209
Query: 498 aaccaggttgagatcaagcctgagatgattggccactatcttgcagagttctccatttcc 557
||||||||||||||||||||||||||||||||||| || ||||| ||||||||||| |||
Sbjct: 210 aaccaggttgagatcaagcctgagatgattggccattaccttgctgagttctccatctcc 269
Query: 558 tacaagccggtcaagcacgggaggcccggtattggtgccactcactcctcgcggtttatc 617
|||||||| || ||||| || ||||||||||| |||||||| |||||||| ||||| |||
Sbjct: 270 tacaagcctgtgaagcatggtaggcccggtatcggtgccacccactcctcccggttcatc 329
Query: 618 cctctgaaatgagtt 632
||||| |||||||||
Sbjct: 330 cctctcaaatgagtt 344
>gb|CN816185.1|CN816185 HRO4517_H07_O13ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4517_H07_O13, mRNA sequence
Length = 416
Score = 180 bits (91), Expect = 1e-045
Identities = 166/191 (86%)
Strand = Plus / Plus
Query: 417 gtgaagacccatctccgcaacatgatcattgtccccgagatgattgggagcattgttggt 476
|||| |||||| ||||||||||||||||| | || ||||||||||| ||| | || |||
Sbjct: 11 gtgaggacccacctccgcaacatgatcatcatgcctgagatgattggaagcgtcgtcggt 70
Query: 477 gtctacaatggcaagaccttcaaccaggttgagatcaagcctgagatgattggccactat 536
||||||| |||||| |||||||| || |||||||||||||||||||||||||||||
Sbjct: 71 atctacaacggcaaggccttcaactccgtcgagatcaagcctgagatgattggccactac 130
Query: 537 cttgcagagttctccatttcctacaagccggtcaagcacgggaggcccggtattggtgcc 596
|| |||||||||||| | ||||||||||| ||||||||||| ||||| ||||||||||||
Sbjct: 131 ctggcagagttctccctctcctacaagccagtcaagcacggaaggcctggtattggtgcc 190
Query: 597 actcactcctc 607
|| ||||||||
Sbjct: 191 acccactcctc 201
>gb|CN819635.1|CN819635 HRO4402_D11_G22ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4402_D11_G22, mRNA
sequence
Length = 354
Score = 157 bits (79), Expect = 2e-038
Identities = 136/155 (87%)
Strand = Plus / Plus
Query: 453 gagatgattgggagcattgttggtgtctacaatggcaagaccttcaaccaggttgagatc 512
||||||||||| ||| | || ||| ||||||| |||||| |||||||| || ||||||
Sbjct: 12 gagatgattggaagcgtcgtcggtatctacaacggcaaggccttcaactccgtcgagatc 71
Query: 513 aagcctgagatgattggccactatcttgcagagttctccatttcctacaagccggtcaag 572
||||||||||||||||||||||| || |||||||||||| | ||||||||||| ||||||
Sbjct: 72 aagcctgagatgattggccactacctggcagagttctccctctcctacaagccagtcaag 131
Query: 573 cacgggaggcccggtattggtgccactcactcctc 607
||||| ||||| |||||||||||||| ||||||||
Sbjct: 132 cacggaaggcctggtattggtgccacccactcctc 166
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1844
Number of Sequences: 8143
Number of extensions: 1844
Number of successful extensions: 561
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 555
Number of HSP's gapped (non-prelim): 4
length of query: 845
length of database: 4,702,463
effective HSP length: 16
effective length of query: 829
effective length of database: 4,572,175
effective search space: 3790333075
effective search space used: 3790333075
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)