BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2404801.2.2
(1076 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF117889.1|AF117889 Avena fatua 40S ribosomal protein S3... 34 0.25
>gb|AF117889.1|AF117889 Avena fatua 40S ribosomal protein S3A mRNA, partial cds
Length = 382
Score = 34.2 bits (17), Expect = 0.25
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 517 tgcaccagctcctgcaggtca 537
||||||||||||| |||||||
Sbjct: 21 tgcaccagctccttcaggtca 1
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2591
Number of Sequences: 8143
Number of extensions: 2591
Number of successful extensions: 732
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 731
Number of HSP's gapped (non-prelim): 1
length of query: 1076
length of database: 4,702,463
effective HSP length: 16
effective length of query: 1060
effective length of database: 4,572,175
effective search space: 4846505500
effective search space used: 4846505500
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)