BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2188214.2.1
(880 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN816242.1|CN816242 HRO4518_E06_I12ZS5 Lib AA071E1X Aven... 96 6e-020
gb|CN816396.1|CN816396 HRO4520_C05_F10ZS5 Lib AA071E1X Aven... 96 6e-020
gb|CN816654.1|CN816654 HRO4523_C06_F11ZS5 Lib AA071E1X Aven... 80 4e-015
gb|CN819728.1|CN819728 HRO4403_D10_H19ZS5 Lib AA069E1X Aven... 80 4e-015
gb|CN821549.1|CN821549 HRO4426_E11_I22ZS5 Lib AA069E1X Aven... 80 4e-015
gb|CN816747.1|CN816747 HRO4524_C11_F22ZS5 Lib AA071E1X Aven... 34 0.20
>gb|CN816242.1|CN816242 HRO4518_E06_I12ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4518_E06_I12, mRNA sequence
Length = 723
Score = 95.6 bits (48), Expect = 6e-020
Identities = 156/192 (81%)
Strand = Plus / Minus
Query: 591 gtgttgtatgacttgcaattctggcacttgtgcgcaatcaaatggaactgcacatctgat 650
||||||||||||| |||| ||||||||||| |||||||||| | ||| |||| |||| |
Sbjct: 361 gtgttgtatgactggcaactctggcacttgagcgcaatcaagttgaaacgcacctctgct 302
Query: 651 attgccccgcagtcgttgcataatatgcggaccattttgtgatcacaggagtcagacaga 710
|||||| | || || |||||||||||||| |||||| | |||| ||||||| | |||
Sbjct: 301 attgcctcacattcattgcataatatgcgaaccattctaccatcataggagtctggcagt 242
Query: 711 gttgccagctccatgtcgagcctttcccatgccttcgacatgtcacaaaccgacttggag 770
|||| | ||| |||| || || ||||||||| | ||||||||||| || |||||||||
Sbjct: 241 cttgctatttccctgtccagtctctcccatgcccttgacatgtcacatactgacttggag 182
Query: 771 caaagggggcat 782
|| || ||||||
Sbjct: 181 cagagcgggcat 170
>gb|CN816396.1|CN816396 HRO4520_C05_F10ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4520_C05_F10, mRNA sequence
Length = 851
Score = 95.6 bits (48), Expect = 6e-020
Identities = 156/192 (81%)
Strand = Plus / Minus
Query: 591 gtgttgtatgacttgcaattctggcacttgtgcgcaatcaaatggaactgcacatctgat 650
||||||||||||| |||| ||||||||||| |||||||||| | ||| |||| |||| |
Sbjct: 804 gtgttgtatgactggcaactctggcacttgagcgcaatcaagttgaaacgcacctctgct 745
Query: 651 attgccccgcagtcgttgcataatatgcggaccattttgtgatcacaggagtcagacaga 710
|||||| | || || |||||||||||||| |||||| | |||| ||||||| | |||
Sbjct: 744 attgcctcacattcattgcataatatgcgaaccattctaccatcataggagtctggcagt 685
Query: 711 gttgccagctccatgtcgagcctttcccatgccttcgacatgtcacaaaccgacttggag 770
|||| | ||| |||| || || ||||||||| | ||||||||||| || |||||||||
Sbjct: 684 cttgctatttccctgtccagtctctcccatgcccttgacatgtcacatactgacttggag 625
Query: 771 caaagggggcat 782
|| || ||||||
Sbjct: 624 cagagcgggcat 613
>gb|CN816654.1|CN816654 HRO4523_C06_F11ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4523_C06_F11, mRNA sequence
Length = 821
Score = 79.8 bits (40), Expect = 4e-015
Identities = 82/96 (85%)
Strand = Plus / Minus
Query: 591 gtgttgtatgacttgcaattctggcacttgtgcgcaatcaaatggaactgcacatctgat 650
||||||||||||| |||| ||||||||||| |||||||||| | ||| |||| |||| |
Sbjct: 717 gtgttgtatgactggcaactctggcacttgagcgcaatcaagttgaaacgcacctctgct 658
Query: 651 attgccccgcagtcgttgcataatatgcggaccatt 686
|||||| | || || |||||||||||||| ||||||
Sbjct: 657 attgcctcacattcattgcataatatgcgaaccatt 622
>gb|CN819728.1|CN819728 HRO4403_D10_H19ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4403_D10_H19, mRNA
sequence
Length = 525
Score = 79.8 bits (40), Expect = 4e-015
Identities = 82/96 (85%)
Strand = Plus / Minus
Query: 591 gtgttgtatgacttgcaattctggcacttgtgcgcaatcaaatggaactgcacatctgat 650
||||||||||||| |||| ||||||||||| |||||||||| | ||| |||| |||| |
Sbjct: 108 gtgttgtatgactggcaactctggcacttgagcgcaatcaagttgaaacgcacgtctgct 49
Query: 651 attgccccgcagtcgttgcataatatgcggaccatt 686
|||||| | || || |||||||||||||| ||||||
Sbjct: 48 attgcctcacattcattgcataatatgcgaaccatt 13
>gb|CN821549.1|CN821549 HRO4426_E11_I22ZS5 Lib AA069E1X Avena sativa cv. Ogle-C etiolated
leaf Avena sativa cDNA clone HRO4426_E11_I22, mRNA
sequence
Length = 462
Score = 79.8 bits (40), Expect = 4e-015
Identities = 79/92 (85%)
Strand = Plus / Minus
Query: 588 cgggtgttgtatgacttgcaattctggcacttgtgcgcaatcaaatggaactgcacatct 647
|||||||||||||| |||||| ||||||||||| |||||||||| | ||| ||||| |||
Sbjct: 102 cgggtgttgtatgagttgcaactctggcacttgagcgcaatcaagttgaaatgcacctct 43
Query: 648 gatattgccccgcagtcgttgcataatatgcg 679
||||||| | || || ||||||||||||||
Sbjct: 42 tgtattgcctcacaatcattgcataatatgcg 11
>gb|CN816747.1|CN816747 HRO4524_C11_F22ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4524_C11_F22, mRNA sequence
Length = 623
Score = 34.2 bits (17), Expect = 0.20
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 232 gcagccgccgccgccgt 248
|||||||||||||||||
Sbjct: 74 gcagccgccgccgccgt 58
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2162
Number of Sequences: 8143
Number of extensions: 2162
Number of successful extensions: 745
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 732
Number of HSP's gapped (non-prelim): 13
length of query: 880
length of database: 4,702,463
effective HSP length: 16
effective length of query: 864
effective length of database: 4,572,175
effective search space: 3950359200
effective search space used: 3950359200
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)