BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1805320.2.1
(955 letters)
Database: Avena_nucl_with_EST.fasta
8143 sequences; 4,702,463 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN815277.1|CN815277 HRO4507_H06_P11ZS5 Lib AA071E1X Aven... 293 1e-079
>gb|CN815277.1|CN815277 HRO4507_H06_P11ZS5 Lib AA071E1X Avena sativa cv. Ogle-C root Avena
sativa cDNA clone HRO4507_H06_P11, mRNA sequence
Length = 458
Score = 293 bits (148), Expect = 1e-079
Identities = 221/244 (90%), Gaps = 1/244 (0%)
Strand = Plus / Minus
Query: 337 ttactcgaaggcccactggttctccctgcggatctcctcttcctcctcaggggtgaagtc 396
|||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||
Sbjct: 283 ttactcgaaggcacactggttctccatgcggatctcctcttcctcctcagccgtgaagtc 224
Query: 397 at-tcttgatgttgaaggtcttgcgaatctcttctggtgtcttgcccttgatcatgtcag 455
| |||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||
Sbjct: 223 gtatcttgatgttgaaggtcttgcggatctcctctggggtcttgcccttgatcatgtcag 164
Query: 456 caacagtctgacaggtcaggtcgagcagacccttgatgttcagatagtttgcagccaaga 515
|||||||||| || || ||||| ||||| ||||||||||| || ||||| ||||||| ||
Sbjct: 163 caacagtctggcacgtaaggtccagcagtcccttgatgttgaggtagttggcagccagga 104
Query: 516 tgaggtcgaaaagcgtggcctggtcgaccttgacgaagtccgcatcccagttcttgaggt 575
|||||||||| || ||||||||||||||||||||||| || || ||||||||||||||||
Sbjct: 103 tgaggtcgaatagggtggcctggtcgaccttgacgaactcagcgtcccagttcttgaggt 44
Query: 576 cctc 579
||||
Sbjct: 43 cctc 40
Database: Avena_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:15 PM
Number of letters in database: 4,702,463
Number of sequences in database: 8143
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2132
Number of Sequences: 8143
Number of extensions: 2132
Number of successful extensions: 578
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 575
Number of HSP's gapped (non-prelim): 1
length of query: 955
length of database: 4,702,463
effective HSP length: 16
effective length of query: 939
effective length of database: 4,572,175
effective search space: 4293272325
effective search space used: 4293272325
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)