BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QCH2g03.yg.2.1
         (537 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CW841437.1|CW841437  ET11212.Ds5.03.20.2003.jw85.750 Arab...    58   2e-006
emb|AX651854.1|  Sequence 720 from Patent WO03000898               58   2e-006
dbj|BA000015.5|  Arabidopsis thaliana DNA, chromosome 5, com...    58   2e-006
emb|AL353013.1|ATT24H18  Arabidopsis thaliana DNA chromosome...    58   2e-006
ref|NM_121303.3|  Arabidopsis thaliana ATGSL12 (GLUCAN SYNTH...    58   2e-006
ref|NC_003076.4|  Arabidopsis thaliana chromosome 5, complet...    58   2e-006
gb|B08932.1|B08932  F3D17-Sp6.1 IGF Arabidopsis thaliana gen...    46   0.006
gb|B08281.1|B08281  F6D9-T7 IGF Arabidopsis thaliana genomic...    44   0.024
gb|B10244.1|B10244  T7O16-Sp6 TAMU Arabidopsis thaliana geno...    44   0.024
gb|AE005172.1|  Arabidopsis thaliana chromosome 1, top arm c...    44   0.024
gb|AF237733.1|AF237733  Arabidopsis thaliana callose synthas...    44   0.024
emb|AX412747.1|  Sequence 511 from Patent WO0222675                44   0.024
emb|AX508002.1|  Sequence 2697 from Patent WO0216655               44   0.024
gb|AC007153.2|  Arabidopsis thaliana chromosome I BAC F3F20 ...    44   0.024
gb|AC005106.2|AC005106  Genomic sequence for Arabidopsis tha...    44   0.024
gb|AC006223.4|  Arabidopsis thaliana chromosome 2 clone F22D...    44   0.024
ref|NM_179847.1|  Arabidopsis thaliana ATGSL03 (GLUCAN SYNTH...    44   0.024
ref|NM_100436.2|  Arabidopsis thaliana CALS1 (CALLOSE SYNTHA...    44   0.024
ref|NC_003071.3|  Arabidopsis thaliana chromosome 2, complet...    44   0.024
ref|NC_003070.5|  Arabidopsis thaliana chromosome 1, complet...    44   0.024
gb|B61727.1|B61727  T18M23TR TAMU Arabidopsis thaliana genom...    42   0.096
gb|AC012395.5|ATAC012395  Arabidopsis thaliana chromosome II...    42   0.096
gb|AC006436.5|  Arabidopsis thaliana chromosome 2 clone F13J...    42   0.096
gb|AC007063.6|  Arabidopsis thaliana chromosome 2 clone T10F...    42   0.096
dbj|BA000014.8|  Arabidopsis thaliana, chromosome 3, complet...    42   0.096
tpg|BK001470.1|  TPA: Arabidopsis thaliana callose synthase ...    42   0.096
gb|AY337762.1|  Arabidopsis thaliana LAP1 (At2g13680) mRNA, ...    42   0.096
ref|NM_111596.1|  Arabidopsis thaliana ATGSL10 (GLUCAN SYNTH...    42   0.096
ref|NM_179622.2|  Arabidopsis thaliana 1,3-beta-glucan synth...    42   0.096
ref|NC_003074.4|  Arabidopsis thaliana chromosome 3, complet...    42   0.096
emb|AL163527.1|ATF17J16  Arabidopsis thaliana DNA chromosome...    40   0.38 
ref|NM_115772.2|  Arabidopsis thaliana ATGSL11 (GLUCAN SYNTH...    40   0.38 
>gb|CW841437.1|CW841437 ET11212.Ds5.03.20.2003.jw85.750 Arabidopsis thaliana Landsberg Ds
           insertion lines Arabidopsis thaliana genomic clone
           ET11212, DNA sequence
          Length = 750

 Score = 58.0 bits (29), Expect = 2e-006
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 132 gacatgaagtttacatatgttgtctcatgccaactatatgg 172
           ||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 655 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 695

 Score = 54.0 bits (27), Expect = 3e-005
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 1   actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 412 actatcgaaaagccttggagcttcaggcattccttgacatggc 454
>emb|AX651854.1| Sequence 720 from Patent WO03000898
          Length = 5892

 Score = 58.0 bits (29), Expect = 2e-006
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 132  gacatgaagtttacatatgttgtctcatgccaactatatgg 172
            ||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 3802 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 3842

 Score = 54.0 bits (27), Expect = 3e-005
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                       
Query: 1    actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
            ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 3656 actatcgaaaagccttggagcttcaggcattccttgacatggc 3698

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 417  gaaggaaagccagaaaacca 436
            ||||||||||||||||||||
Sbjct: 4093 gaaggaaagccagaaaacca 4112
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
          Length = 23810767

 Score = 58.0 bits (29), Expect = 2e-006
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                        
Query: 132     gacatgaagtttacatatgttgtctcatgccaactatatgg 172
               ||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 3926770 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 3926730

 Score = 54.0 bits (27), Expect = 3e-005
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                          
Query: 1       actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
               ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 3927013 actatcgaaaagccttggagcttcaggcattccttgacatggc 3926971

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 417     gaaggaaagccagaaaacca 436
               ||||||||||||||||||||
Sbjct: 3926051 gaaggaaagccagaaaacca 3926032
>emb|AL353013.1|ATT24H18 Arabidopsis thaliana DNA chromosome 5, BAC clone T24H18 (ESSA project)
          Length = 90020

 Score = 58.0 bits (29), Expect = 2e-006
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                      
Query: 132   gacatgaagtttacatatgttgtctcatgccaactatatgg 172
             ||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 65611 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 65571

 Score = 54.0 bits (27), Expect = 3e-005
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                        
Query: 1     actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
             ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 65854 actatcgaaaagccttggagcttcaggcattccttgacatggc 65812

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 417   gaaggaaagccagaaaacca 436
             ||||||||||||||||||||
Sbjct: 64892 gaaggaaagccagaaaacca 64873
>ref|NM_121303.3| Arabidopsis thaliana ATGSL12 (GLUCAN SYNTHASE-LIKE 12);
            1,3-beta-glucan synthase/ transferase, transferring
            glycosyl groups AT5G13000 (ATGSL12) mRNA, complete cds
          Length = 6194

 Score = 58.0 bits (29), Expect = 2e-006
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 132  gacatgaagtttacatatgttgtctcatgccaactatatgg 172
            ||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 3944 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 3984

 Score = 54.0 bits (27), Expect = 3e-005
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                       
Query: 1    actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
            ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 3798 actatcgaaaagccttggagcttcaggcattccttgacatggc 3840

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 417  gaaggaaagccagaaaacca 436
            ||||||||||||||||||||
Sbjct: 4235 gaaggaaagccagaaaacca 4254
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
          Length = 26992728

 Score = 58.0 bits (29), Expect = 2e-006
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                        
Query: 132     gacatgaagtttacatatgttgtctcatgccaactatatgg 172
               ||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 4113797 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 4113757

 Score = 54.0 bits (27), Expect = 3e-005
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                          
Query: 1       actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
               ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 4114040 actatcgaaaagccttggagcttcaggcattccttgacatggc 4113998

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 417     gaaggaaagccagaaaacca 436
               ||||||||||||||||||||
Sbjct: 4113078 gaaggaaagccagaaaacca 4113059
>gb|B08932.1|B08932 F3D17-Sp6.1 IGF Arabidopsis thaliana genomic clone F3D17, DNA
           sequence
          Length = 1145

 Score = 46.1 bits (23), Expect = 0.006
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 6   cgaaaagctttggagcttcaggcttttcttgatatggccaacaatga 52
           ||||| |||||||| |||||||| || ||||||||||| ||| ||||
Sbjct: 143 cgaaaggctttggaacttcaggccttccttgatatggcaaacgatga 189
>gb|B08281.1|B08281 F6D9-T7 IGF Arabidopsis thaliana genomic clone F6D9, DNA sequence
          Length = 1173

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 6   cgaaaagctttggagcttcaggcttttcttgatatggc 43
           ||||| |||||||| |||||||| || |||||||||||
Sbjct: 118 cgaaaggctttggaacttcaggccttccttgatatggc 155
>gb|B10244.1|B10244 T7O16-Sp6 TAMU Arabidopsis thaliana genomic clone T7O16, DNA
           sequence
          Length = 887

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 6   cgaaaagctttggagcttcaggcttttcttgatatggc 43
           ||||| |||||||| |||||||| || |||||||||||
Sbjct: 213 cgaaaggctttggaacttcaggccttccttgatatggc 250
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
          Length = 14221815

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                     
Query: 6       cgaaaagctttggagcttcaggcttttcttgatatggc 43
               ||||| |||||||| |||||||| || |||||||||||
Sbjct: 1651180 cgaaaggctttggaacttcaggccttccttgatatggc 1651143
>gb|AF237733.1|AF237733 Arabidopsis thaliana callose synthase 1 catalytic subunit (CalS1)
            mRNA, complete cds
          Length = 6007

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 6    cgaaaagctttggagcttcaggcttttcttgatatggc 43
            ||||| |||||||| |||||||| || |||||||||||
Sbjct: 3511 cgaaaggctttggaacttcaggccttccttgatatggc 3548
>emb|AX412747.1| Sequence 511 from Patent WO0222675
          Length = 5577

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 6    cgaaaagctttggagcttcaggcttttcttgatatggc 43
            ||||| |||||||| |||||||| || |||||||||||
Sbjct: 3364 cgaaaggctttggaacttcaggccttccttgatatggc 3401
>emb|AX508002.1| Sequence 2697 from Patent WO0216655
          Length = 5577

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 6    cgaaaagctttggagcttcaggcttttcttgatatggc 43
            ||||| |||||||| |||||||| || |||||||||||
Sbjct: 3364 cgaaaggctttggaacttcaggccttccttgatatggc 3401
>gb|AC007153.2| Arabidopsis thaliana chromosome I BAC F3F20 genomic sequence, complete
             sequence
          Length = 103223

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 6     cgaaaagctttggagcttcaggcttttcttgatatggc 43
             ||||| |||||||| |||||||| || |||||||||||
Sbjct: 32828 cgaaaggctttggaacttcaggccttccttgatatggc 32791
>gb|AC005106.2|AC005106 Genomic sequence for Arabidopsis thaliana BAC T25N20 from chromosome I,
             complete sequence
          Length = 84203

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 6     cgaaaagctttggagcttcaggcttttcttgatatggc 43
             ||||| |||||||| |||||||| || |||||||||||
Sbjct: 83377 cgaaaggctttggaacttcaggccttccttgatatggc 83340
>gb|AC006223.4| Arabidopsis thaliana chromosome 2 clone F22D22 map TEn5, complete
             sequence
          Length = 103194

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 6     cgaaaagctttggagcttcaggcttttcttgatatggc 43
             ||||| ||||||||||| ||||| || |||||||||||
Sbjct: 92859 cgaaaggctttggagctccaggccttccttgatatggc 92822
>ref|NM_179847.1| Arabidopsis thaliana ATGSL03 (GLUCAN SYNTHASE-LIKE 3);
            1,3-beta-glucan synthase/ transferase, transferring
            glycosyl groups AT2G31960 (ATGSL03) mRNA, complete cds
          Length = 5880

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 6    cgaaaagctttggagcttcaggcttttcttgatatggc 43
            ||||| ||||||||||| ||||| || |||||||||||
Sbjct: 3529 cgaaaggctttggagctccaggccttccttgatatggc 3566
>ref|NM_100436.2| Arabidopsis thaliana CALS1 (CALLOSE SYNTHASE 1); transferase,
            transferring glycosyl groups AT1G05570 (CALS1) mRNA,
            complete cds
          Length = 6022

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 6    cgaaaagctttggagcttcaggcttttcttgatatggc 43
            ||||| |||||||| |||||||| || |||||||||||
Sbjct: 3511 cgaaaggctttggaacttcaggccttccttgatatggc 3548
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
          Length = 19705359

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 6        cgaaaagctttggagcttcaggcttttcttgatatggc 43
                ||||| ||||||||||| ||||| || |||||||||||
Sbjct: 13603628 cgaaaggctttggagctccaggccttccttgatatggc 13603665

 Score = 42.1 bits (21), Expect = 0.096
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 19      agcttcaggcttttcttgatatggc 43
               ||||||||||||||||||| |||||
Sbjct: 5710028 agcttcaggcttttcttgacatggc 5710052
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
          Length = 30432563

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                     
Query: 6       cgaaaagctttggagcttcaggcttttcttgatatggc 43
               ||||| |||||||| |||||||| || |||||||||||
Sbjct: 1651303 cgaaaggctttggaacttcaggccttccttgatatggc 1651266
>gb|B61727.1|B61727 T18M23TR TAMU Arabidopsis thaliana genomic clone T18M23, DNA
          sequence
          Length = 449

 Score = 42.1 bits (21), Expect = 0.096
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 19 agcttcaggcttttcttgatatggc 43
          ||||||||||||||||||| |||||
Sbjct: 6  agcttcaggcttttcttgacatggc 30
>gb|AC012395.5|ATAC012395 Arabidopsis thaliana chromosome III BAC T1B9 genomic sequence, complete
             sequence
          Length = 99128

 Score = 42.1 bits (21), Expect = 0.096
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 138   aagtttacatatgttgtctcatgccaactatatggaa 174
             ||||| |||||||||||| |||||||  |||||||||
Sbjct: 64553 aagttcacatatgttgtcacatgccagatatatggaa 64589
>gb|AC006436.5| Arabidopsis thaliana chromosome 2 clone F13J11 map mi398, complete
             sequence
          Length = 104009

 Score = 42.1 bits (21), Expect = 0.096
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 19    agcttcaggcttttcttgatatggc 43
             ||||||||||||||||||| |||||
Sbjct: 11171 agcttcaggcttttcttgacatggc 11195
>gb|AC007063.6| Arabidopsis thaliana chromosome 2 clone T10F5 map PR1, complete
             sequence
          Length = 102585

 Score = 42.1 bits (21), Expect = 0.096
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 19    agcttcaggcttttcttgatatggc 43
             ||||||||||||||||||| |||||
Sbjct: 93373 agcttcaggcttttcttgacatggc 93397
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
          Length = 23403063

 Score = 42.1 bits (21), Expect = 0.096
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                    
Query: 138     aagtttacatatgttgtctcatgccaactatatggaa 174
               ||||| |||||||||||| |||||||  |||||||||
Sbjct: 2296188 aagttcacatatgttgtcacatgccagatatatggaa 2296224

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 474      caaactatagatatgaatca 493
                ||||||||||||||||||||
Sbjct: 21809719 caaactatagatatgaatca 21809738
>tpg|BK001470.1| TPA: Arabidopsis thaliana callose synthase (LAP1) mRNA, complete cds
          Length = 5772

 Score = 42.1 bits (21), Expect = 0.096
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 19   agcttcaggcttttcttgatatggc 43
            ||||||||||||||||||| |||||
Sbjct: 3491 agcttcaggcttttcttgacatggc 3515
>gb|AY337762.1| Arabidopsis thaliana LAP1 (At2g13680) mRNA, complete cds
          Length = 5950

 Score = 42.1 bits (21), Expect = 0.096
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 19   agcttcaggcttttcttgatatggc 43
            ||||||||||||||||||| |||||
Sbjct: 3644 agcttcaggcttttcttgacatggc 3668
>ref|NM_111596.1| Arabidopsis thaliana ATGSL10 (GLUCAN SYNTHASE-LIKE 10);
            1,3-beta-glucan synthase AT3G07160 (ATGSL10) mRNA,
            complete cds
          Length = 5981

 Score = 42.1 bits (21), Expect = 0.096
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 138  aagtttacatatgttgtctcatgccaactatatggaa 174
            ||||| |||||||||||| |||||||  |||||||||
Sbjct: 3664 aagttcacatatgttgtcacatgccagatatatggaa 3700
>ref|NM_179622.2| Arabidopsis thaliana 1,3-beta-glucan synthase AT2G13680 mRNA,
            complete cds
          Length = 5772

 Score = 42.1 bits (21), Expect = 0.096
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 19   agcttcaggcttttcttgatatggc 43
            ||||||||||||||||||| |||||
Sbjct: 3491 agcttcaggcttttcttgacatggc 3515
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score = 42.1 bits (21), Expect = 0.096
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 138     aagtttacatatgttgtctcatgccaactatatggaa 174
               ||||| |||||||||||| |||||||  |||||||||
Sbjct: 2270236 aagttcacatatgttgtcacatgccagatatatggaa 2270200

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 474      caaactatagatatgaatca 493
                ||||||||||||||||||||
Sbjct: 21862151 caaactatagatatgaatca 21862170
>emb|AL163527.1|ATF17J16 Arabidopsis thaliana DNA chromosome 3, BAC clone F17J16
          Length = 89517

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 474   caaactatagatatgaatca 493
             ||||||||||||||||||||
Sbjct: 64405 caaactatagatatgaatca 64424
>ref|NM_115772.2| Arabidopsis thaliana ATGSL11 (GLUCAN SYNTHASE-LIKE 11);
            1,3-beta-glucan synthase/ transferase, transferring
            glycosyl groups AT3G59100 (ATGSL11) mRNA, complete cds
          Length = 5805

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 474  caaactatagatatgaatca 493
            ||||||||||||||||||||
Sbjct: 3958 caaactatagatatgaatca 3977
  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 276,560
Number of Sequences: 1013581
Number of extensions: 276560
Number of successful extensions: 22134
Number of sequences better than  0.5: 32
Number of HSP's better than  0.5 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20908
Number of HSP's gapped (non-prelim): 1226
length of query: 537
length of database: 908,940,872
effective HSP length: 20
effective length of query: 517
effective length of database: 888,669,252
effective search space: 459442003284
effective search space used: 459442003284
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)