BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCH2g03.yg.2.1
(537 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW841437.1|CW841437 ET11212.Ds5.03.20.2003.jw85.750 Arab... 58 2e-006
emb|AX651854.1| Sequence 720 from Patent WO03000898 58 2e-006
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 58 2e-006
emb|AL353013.1|ATT24H18 Arabidopsis thaliana DNA chromosome... 58 2e-006
ref|NM_121303.3| Arabidopsis thaliana ATGSL12 (GLUCAN SYNTH... 58 2e-006
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 58 2e-006
gb|B08932.1|B08932 F3D17-Sp6.1 IGF Arabidopsis thaliana gen... 46 0.006
gb|B08281.1|B08281 F6D9-T7 IGF Arabidopsis thaliana genomic... 44 0.024
gb|B10244.1|B10244 T7O16-Sp6 TAMU Arabidopsis thaliana geno... 44 0.024
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 44 0.024
gb|AF237733.1|AF237733 Arabidopsis thaliana callose synthas... 44 0.024
emb|AX412747.1| Sequence 511 from Patent WO0222675 44 0.024
emb|AX508002.1| Sequence 2697 from Patent WO0216655 44 0.024
gb|AC007153.2| Arabidopsis thaliana chromosome I BAC F3F20 ... 44 0.024
gb|AC005106.2|AC005106 Genomic sequence for Arabidopsis tha... 44 0.024
gb|AC006223.4| Arabidopsis thaliana chromosome 2 clone F22D... 44 0.024
ref|NM_179847.1| Arabidopsis thaliana ATGSL03 (GLUCAN SYNTH... 44 0.024
ref|NM_100436.2| Arabidopsis thaliana CALS1 (CALLOSE SYNTHA... 44 0.024
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 44 0.024
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 44 0.024
gb|B61727.1|B61727 T18M23TR TAMU Arabidopsis thaliana genom... 42 0.096
gb|AC012395.5|ATAC012395 Arabidopsis thaliana chromosome II... 42 0.096
gb|AC006436.5| Arabidopsis thaliana chromosome 2 clone F13J... 42 0.096
gb|AC007063.6| Arabidopsis thaliana chromosome 2 clone T10F... 42 0.096
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 42 0.096
tpg|BK001470.1| TPA: Arabidopsis thaliana callose synthase ... 42 0.096
gb|AY337762.1| Arabidopsis thaliana LAP1 (At2g13680) mRNA, ... 42 0.096
ref|NM_111596.1| Arabidopsis thaliana ATGSL10 (GLUCAN SYNTH... 42 0.096
ref|NM_179622.2| Arabidopsis thaliana 1,3-beta-glucan synth... 42 0.096
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 42 0.096
emb|AL163527.1|ATF17J16 Arabidopsis thaliana DNA chromosome... 40 0.38
ref|NM_115772.2| Arabidopsis thaliana ATGSL11 (GLUCAN SYNTH... 40 0.38
>gb|CW841437.1|CW841437 ET11212.Ds5.03.20.2003.jw85.750 Arabidopsis thaliana Landsberg Ds
insertion lines Arabidopsis thaliana genomic clone
ET11212, DNA sequence
Length = 750
Score = 58.0 bits (29), Expect = 2e-006
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 132 gacatgaagtttacatatgttgtctcatgccaactatatgg 172
||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 655 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 695
Score = 54.0 bits (27), Expect = 3e-005
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 1 actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 412 actatcgaaaagccttggagcttcaggcattccttgacatggc 454
>emb|AX651854.1| Sequence 720 from Patent WO03000898
Length = 5892
Score = 58.0 bits (29), Expect = 2e-006
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 132 gacatgaagtttacatatgttgtctcatgccaactatatgg 172
||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 3802 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 3842
Score = 54.0 bits (27), Expect = 3e-005
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 1 actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 3656 actatcgaaaagccttggagcttcaggcattccttgacatggc 3698
Score = 40.1 bits (20), Expect = 0.38
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 417 gaaggaaagccagaaaacca 436
||||||||||||||||||||
Sbjct: 4093 gaaggaaagccagaaaacca 4112
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 58.0 bits (29), Expect = 2e-006
Identities = 38/41 (92%)
Strand = Plus / Minus
Query: 132 gacatgaagtttacatatgttgtctcatgccaactatatgg 172
||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 3926770 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 3926730
Score = 54.0 bits (27), Expect = 3e-005
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 1 actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 3927013 actatcgaaaagccttggagcttcaggcattccttgacatggc 3926971
Score = 40.1 bits (20), Expect = 0.38
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 417 gaaggaaagccagaaaacca 436
||||||||||||||||||||
Sbjct: 3926051 gaaggaaagccagaaaacca 3926032
>emb|AL353013.1|ATT24H18 Arabidopsis thaliana DNA chromosome 5, BAC clone T24H18 (ESSA project)
Length = 90020
Score = 58.0 bits (29), Expect = 2e-006
Identities = 38/41 (92%)
Strand = Plus / Minus
Query: 132 gacatgaagtttacatatgttgtctcatgccaactatatgg 172
||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 65611 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 65571
Score = 54.0 bits (27), Expect = 3e-005
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 1 actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 65854 actatcgaaaagccttggagcttcaggcattccttgacatggc 65812
Score = 40.1 bits (20), Expect = 0.38
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 417 gaaggaaagccagaaaacca 436
||||||||||||||||||||
Sbjct: 64892 gaaggaaagccagaaaacca 64873
>ref|NM_121303.3| Arabidopsis thaliana ATGSL12 (GLUCAN SYNTHASE-LIKE 12);
1,3-beta-glucan synthase/ transferase, transferring
glycosyl groups AT5G13000 (ATGSL12) mRNA, complete cds
Length = 6194
Score = 58.0 bits (29), Expect = 2e-006
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 132 gacatgaagtttacatatgttgtctcatgccaactatatgg 172
||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 3944 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 3984
Score = 54.0 bits (27), Expect = 3e-005
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 1 actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 3798 actatcgaaaagccttggagcttcaggcattccttgacatggc 3840
Score = 40.1 bits (20), Expect = 0.38
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 417 gaaggaaagccagaaaacca 436
||||||||||||||||||||
Sbjct: 4235 gaaggaaagccagaaaacca 4254
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 58.0 bits (29), Expect = 2e-006
Identities = 38/41 (92%)
Strand = Plus / Minus
Query: 132 gacatgaagtttacatatgttgtctcatgccaactatatgg 172
||||||||||||||||||||||| ||||| |||| ||||||
Sbjct: 4113797 gacatgaagtttacatatgttgtatcatgtcaacaatatgg 4113757
Score = 54.0 bits (27), Expect = 3e-005
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 1 actatcgaaaagctttggagcttcaggcttttcttgatatggc 43
||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 4114040 actatcgaaaagccttggagcttcaggcattccttgacatggc 4113998
Score = 40.1 bits (20), Expect = 0.38
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 417 gaaggaaagccagaaaacca 436
||||||||||||||||||||
Sbjct: 4113078 gaaggaaagccagaaaacca 4113059
>gb|B08932.1|B08932 F3D17-Sp6.1 IGF Arabidopsis thaliana genomic clone F3D17, DNA
sequence
Length = 1145
Score = 46.1 bits (23), Expect = 0.006
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggccaacaatga 52
||||| |||||||| |||||||| || ||||||||||| ||| ||||
Sbjct: 143 cgaaaggctttggaacttcaggccttccttgatatggcaaacgatga 189
>gb|B08281.1|B08281 F6D9-T7 IGF Arabidopsis thaliana genomic clone F6D9, DNA sequence
Length = 1173
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| |||||||| |||||||| || |||||||||||
Sbjct: 118 cgaaaggctttggaacttcaggccttccttgatatggc 155
>gb|B10244.1|B10244 T7O16-Sp6 TAMU Arabidopsis thaliana genomic clone T7O16, DNA
sequence
Length = 887
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| |||||||| |||||||| || |||||||||||
Sbjct: 213 cgaaaggctttggaacttcaggccttccttgatatggc 250
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| |||||||| |||||||| || |||||||||||
Sbjct: 1651180 cgaaaggctttggaacttcaggccttccttgatatggc 1651143
>gb|AF237733.1|AF237733 Arabidopsis thaliana callose synthase 1 catalytic subunit (CalS1)
mRNA, complete cds
Length = 6007
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| |||||||| |||||||| || |||||||||||
Sbjct: 3511 cgaaaggctttggaacttcaggccttccttgatatggc 3548
>emb|AX412747.1| Sequence 511 from Patent WO0222675
Length = 5577
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| |||||||| |||||||| || |||||||||||
Sbjct: 3364 cgaaaggctttggaacttcaggccttccttgatatggc 3401
>emb|AX508002.1| Sequence 2697 from Patent WO0216655
Length = 5577
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| |||||||| |||||||| || |||||||||||
Sbjct: 3364 cgaaaggctttggaacttcaggccttccttgatatggc 3401
>gb|AC007153.2| Arabidopsis thaliana chromosome I BAC F3F20 genomic sequence, complete
sequence
Length = 103223
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| |||||||| |||||||| || |||||||||||
Sbjct: 32828 cgaaaggctttggaacttcaggccttccttgatatggc 32791
>gb|AC005106.2|AC005106 Genomic sequence for Arabidopsis thaliana BAC T25N20 from chromosome I,
complete sequence
Length = 84203
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| |||||||| |||||||| || |||||||||||
Sbjct: 83377 cgaaaggctttggaacttcaggccttccttgatatggc 83340
>gb|AC006223.4| Arabidopsis thaliana chromosome 2 clone F22D22 map TEn5, complete
sequence
Length = 103194
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| ||||||||||| ||||| || |||||||||||
Sbjct: 92859 cgaaaggctttggagctccaggccttccttgatatggc 92822
>ref|NM_179847.1| Arabidopsis thaliana ATGSL03 (GLUCAN SYNTHASE-LIKE 3);
1,3-beta-glucan synthase/ transferase, transferring
glycosyl groups AT2G31960 (ATGSL03) mRNA, complete cds
Length = 5880
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| ||||||||||| ||||| || |||||||||||
Sbjct: 3529 cgaaaggctttggagctccaggccttccttgatatggc 3566
>ref|NM_100436.2| Arabidopsis thaliana CALS1 (CALLOSE SYNTHASE 1); transferase,
transferring glycosyl groups AT1G05570 (CALS1) mRNA,
complete cds
Length = 6022
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| |||||||| |||||||| || |||||||||||
Sbjct: 3511 cgaaaggctttggaacttcaggccttccttgatatggc 3548
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| ||||||||||| ||||| || |||||||||||
Sbjct: 13603628 cgaaaggctttggagctccaggccttccttgatatggc 13603665
Score = 42.1 bits (21), Expect = 0.096
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 19 agcttcaggcttttcttgatatggc 43
||||||||||||||||||| |||||
Sbjct: 5710028 agcttcaggcttttcttgacatggc 5710052
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 44.1 bits (22), Expect = 0.024
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 6 cgaaaagctttggagcttcaggcttttcttgatatggc 43
||||| |||||||| |||||||| || |||||||||||
Sbjct: 1651303 cgaaaggctttggaacttcaggccttccttgatatggc 1651266
>gb|B61727.1|B61727 T18M23TR TAMU Arabidopsis thaliana genomic clone T18M23, DNA
sequence
Length = 449
Score = 42.1 bits (21), Expect = 0.096
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 19 agcttcaggcttttcttgatatggc 43
||||||||||||||||||| |||||
Sbjct: 6 agcttcaggcttttcttgacatggc 30
>gb|AC012395.5|ATAC012395 Arabidopsis thaliana chromosome III BAC T1B9 genomic sequence, complete
sequence
Length = 99128
Score = 42.1 bits (21), Expect = 0.096
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 138 aagtttacatatgttgtctcatgccaactatatggaa 174
||||| |||||||||||| ||||||| |||||||||
Sbjct: 64553 aagttcacatatgttgtcacatgccagatatatggaa 64589
>gb|AC006436.5| Arabidopsis thaliana chromosome 2 clone F13J11 map mi398, complete
sequence
Length = 104009
Score = 42.1 bits (21), Expect = 0.096
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 19 agcttcaggcttttcttgatatggc 43
||||||||||||||||||| |||||
Sbjct: 11171 agcttcaggcttttcttgacatggc 11195
>gb|AC007063.6| Arabidopsis thaliana chromosome 2 clone T10F5 map PR1, complete
sequence
Length = 102585
Score = 42.1 bits (21), Expect = 0.096
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 19 agcttcaggcttttcttgatatggc 43
||||||||||||||||||| |||||
Sbjct: 93373 agcttcaggcttttcttgacatggc 93397
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 42.1 bits (21), Expect = 0.096
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 138 aagtttacatatgttgtctcatgccaactatatggaa 174
||||| |||||||||||| ||||||| |||||||||
Sbjct: 2296188 aagttcacatatgttgtcacatgccagatatatggaa 2296224
Score = 40.1 bits (20), Expect = 0.38
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 474 caaactatagatatgaatca 493
||||||||||||||||||||
Sbjct: 21809719 caaactatagatatgaatca 21809738
>tpg|BK001470.1| TPA: Arabidopsis thaliana callose synthase (LAP1) mRNA, complete cds
Length = 5772
Score = 42.1 bits (21), Expect = 0.096
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 19 agcttcaggcttttcttgatatggc 43
||||||||||||||||||| |||||
Sbjct: 3491 agcttcaggcttttcttgacatggc 3515
>gb|AY337762.1| Arabidopsis thaliana LAP1 (At2g13680) mRNA, complete cds
Length = 5950
Score = 42.1 bits (21), Expect = 0.096
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 19 agcttcaggcttttcttgatatggc 43
||||||||||||||||||| |||||
Sbjct: 3644 agcttcaggcttttcttgacatggc 3668
>ref|NM_111596.1| Arabidopsis thaliana ATGSL10 (GLUCAN SYNTHASE-LIKE 10);
1,3-beta-glucan synthase AT3G07160 (ATGSL10) mRNA,
complete cds
Length = 5981
Score = 42.1 bits (21), Expect = 0.096
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 138 aagtttacatatgttgtctcatgccaactatatggaa 174
||||| |||||||||||| ||||||| |||||||||
Sbjct: 3664 aagttcacatatgttgtcacatgccagatatatggaa 3700
>ref|NM_179622.2| Arabidopsis thaliana 1,3-beta-glucan synthase AT2G13680 mRNA,
complete cds
Length = 5772
Score = 42.1 bits (21), Expect = 0.096
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 19 agcttcaggcttttcttgatatggc 43
||||||||||||||||||| |||||
Sbjct: 3491 agcttcaggcttttcttgacatggc 3515
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 42.1 bits (21), Expect = 0.096
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 138 aagtttacatatgttgtctcatgccaactatatggaa 174
||||| |||||||||||| ||||||| |||||||||
Sbjct: 2270236 aagttcacatatgttgtcacatgccagatatatggaa 2270200
Score = 40.1 bits (20), Expect = 0.38
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 474 caaactatagatatgaatca 493
||||||||||||||||||||
Sbjct: 21862151 caaactatagatatgaatca 21862170
>emb|AL163527.1|ATF17J16 Arabidopsis thaliana DNA chromosome 3, BAC clone F17J16
Length = 89517
Score = 40.1 bits (20), Expect = 0.38
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 474 caaactatagatatgaatca 493
||||||||||||||||||||
Sbjct: 64405 caaactatagatatgaatca 64424
>ref|NM_115772.2| Arabidopsis thaliana ATGSL11 (GLUCAN SYNTHASE-LIKE 11);
1,3-beta-glucan synthase/ transferase, transferring
glycosyl groups AT3G59100 (ATGSL11) mRNA, complete cds
Length = 5805
Score = 40.1 bits (20), Expect = 0.38
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 474 caaactatagatatgaatca 493
||||||||||||||||||||
Sbjct: 3958 caaactatagatatgaatca 3977
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 276,560
Number of Sequences: 1013581
Number of extensions: 276560
Number of successful extensions: 22134
Number of sequences better than 0.5: 32
Number of HSP's better than 0.5 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20908
Number of HSP's gapped (non-prelim): 1226
length of query: 537
length of database: 908,940,872
effective HSP length: 20
effective length of query: 517
effective length of database: 888,669,252
effective search space: 459442003284
effective search space used: 459442003284
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)