BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCG11e12.yg.2.1
(636 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone poo... 44 0.029
emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.11
gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasit... 40 0.45
gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone poo... 40 0.45
gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG... 40 0.45
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 40 0.45
gb|AC004122.1| Arabidopsis thaliana chromosome I BAC T27I1 ... 40 0.45
emb|AJ838785.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.45
ref|NM_100879.2| Arabidopsis thaliana hydrolase, hydrolyzin... 40 0.45
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 40 0.45
>gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLC01 similar to PSII 32Kda protein, mRNA
sequence
Length = 358
Score = 44.1 bits (22), Expect = 0.029
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 614 aaagtacctgcccgggcggccg 635
||||||||||||||||||||||
Sbjct: 326 aaagtacctgcccgggcggccg 347
>emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequence GK-708B12-022965,
genomic survey sequence
Length = 378
Score = 42.1 bits (21), Expect = 0.11
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 615 aagtacctgcccgggcggccg 635
|||||||||||||||||||||
Sbjct: 53 aagtacctgcccgggcggccg 33
>gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-EB10, mRNA sequence
Length = 406
Score = 40.1 bits (20), Expect = 0.45
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 616 agtacctgcccgggcggccg 635
||||||||||||||||||||
Sbjct: 381 agtacctgcccgggcggccg 400
>gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLH04 similar to PsbA gene in chloroplast
genome, mRNA sequence
Length = 360
Score = 40.1 bits (20), Expect = 0.45
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 616 agtacctgcccgggcggccg 635
||||||||||||||||||||
Sbjct: 331 agtacctgcccgggcggccg 350
>gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG-GR forward subtraction library
Arabidopsis thaliana cDNA clone 10D03, mRNA sequence
Length = 640
Score = 40.1 bits (20), Expect = 0.45
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 616 agtacctgcccgggcggccg 635
||||||||||||||||||||
Sbjct: 122 agtacctgcccgggcggccg 141
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 40.1 bits (20), Expect = 0.45
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 281 tggcagggtcttgaacaagatattacaa 308
||||| || |||||||||||||||||||
Sbjct: 3279263 tggcaaggacttgaacaagatattacaa 3279290
>gb|AC004122.1| Arabidopsis thaliana chromosome I BAC T27I1 genomic sequence, complete
sequence
Length = 67878
Score = 40.1 bits (20), Expect = 0.45
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 281 tggcagggtcttgaacaagatattacaa 308
||||| || |||||||||||||||||||
Sbjct: 24755 tggcaaggacttgaacaagatattacaa 24782
>emb|AJ838785.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
405F08
Length = 664
Score = 40.1 bits (20), Expect = 0.45
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 615 aagtacctgcccgggcggcc 634
||||||||||||||||||||
Sbjct: 132 aagtacctgcccgggcggcc 151
>ref|NM_100879.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT1G10050 mRNA, complete cds
Length = 3230
Score = 40.1 bits (20), Expect = 0.45
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 281 tggcagggtcttgaacaagatattacaa 308
||||| || |||||||||||||||||||
Sbjct: 172 tggcaaggacttgaacaagatattacaa 199
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 40.1 bits (20), Expect = 0.45
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 281 tggcagggtcttgaacaagatattacaa 308
||||| || |||||||||||||||||||
Sbjct: 3279443 tggcaaggacttgaacaagatattacaa 3279470
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 398,955
Number of Sequences: 1013581
Number of extensions: 398955
Number of successful extensions: 32850
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32492
Number of HSP's gapped (non-prelim): 358
length of query: 636
length of database: 908,940,872
effective HSP length: 20
effective length of query: 616
effective length of database: 888,669,252
effective search space: 547420259232
effective search space used: 547420259232
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)