BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCA17a05.yg.2.1
(548 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV544142.1|AV544142 AV544142 Arabidopsis thaliana roots ... 62 1e-007
gb|AV563349.1|AV563349 AV563349 Arabidopsis thaliana green ... 62 1e-007
gb|AY090451.1| Arabidopsis thaliana At1g74800/F25A4_38 mRNA... 62 1e-007
ref|NM_106138.2| Arabidopsis thaliana transferase, transfer... 62 1e-007
gb|BZ763251.1|BZ763251 SALK_115741.53.50.x Arabidopsis thal... 54 3e-005
gb|AV560615.1|AV560615 AV560615 Arabidopsis thaliana green ... 54 3e-005
gb|BP649393.1|BP649393 BP649393 RAFL19 Arabidopsis thaliana... 54 3e-005
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 54 3e-005
gb|AC008263.2|F25A4 Arabidopsis thaliana chromosome 1 BAC F... 54 3e-005
gb|AC000348.2|AC000348 Genomic sequence for Arabidopsis tha... 54 3e-005
dbj|AK118254.1| Arabidopsis thaliana At1g27120 mRNA for unk... 54 3e-005
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 54 3e-005
ref|NM_102474.2| Arabidopsis thaliana transferase, transfer... 54 3e-005
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 54 3e-005
ref|NM_118224.2| Arabidopsis thaliana transferase, transfer... 48 0.002
emb|AL083949.1|CNS00P1R Arabidopsis thaliana genome survey ... 46 0.006
gb|BZ768878.1|BZ768878 SALK_141126.30.20.x Arabidopsis thal... 46 0.006
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 46 0.006
emb|AL080282.1|ATT13K14 Arabidopsis thaliana DNA chromosome... 46 0.006
emb|AL161554.2|ATCHRIV54 Arabidopsis thaliana DNA chromosom... 46 0.006
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 46 0.006
gb|AU230384.1|AU230384 AU230384 RAFL19 Arabidopsis thaliana... 40 0.39
>gb|AV544142.1|AV544142 AV544142 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ34e04F 3', mRNA sequence
Length = 635
Score = 61.9 bits (31), Expect = 1e-007
Identities = 40/43 (93%)
Strand = Plus / Plus
Query: 449 acccacatgcccatgctcacgtcctccatcttgaacagccgta 491
|||||||| |||| ||||||||||||||||||||||||||||
Sbjct: 396 acccacattcccacactcacgtcctccatcttgaacagccgta 438
>gb|AV563349.1|AV563349 AV563349 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ185g10F 3', mRNA sequence
Length = 499
Score = 61.9 bits (31), Expect = 1e-007
Identities = 40/43 (93%)
Strand = Plus / Plus
Query: 449 acccacatgcccatgctcacgtcctccatcttgaacagccgta 491
|||||||| |||| ||||||||||||||||||||||||||||
Sbjct: 427 acccacattcccacactcacgtcctccatcttgaacagccgta 469
>gb|AY090451.1| Arabidopsis thaliana At1g74800/F25A4_38 mRNA, complete cds
Length = 2391
Score = 61.9 bits (31), Expect = 1e-007
Identities = 40/43 (93%)
Strand = Plus / Minus
Query: 449 acccacatgcccatgctcacgtcctccatcttgaacagccgta 491
|||||||| |||| ||||||||||||||||||||||||||||
Sbjct: 1963 acccacattcccacactcacgtcctccatcttgaacagccgta 1921
>ref|NM_106138.2| Arabidopsis thaliana transferase, transferring glycosyl groups /
transferase, transferring hexosyl groups AT1G74800 mRNA,
complete cds
Length = 2391
Score = 61.9 bits (31), Expect = 1e-007
Identities = 40/43 (93%)
Strand = Plus / Minus
Query: 449 acccacatgcccatgctcacgtcctccatcttgaacagccgta 491
|||||||| |||| ||||||||||||||||||||||||||||
Sbjct: 1963 acccacattcccacactcacgtcctccatcttgaacagccgta 1921
>gb|BZ763251.1|BZ763251 SALK_115741.53.50.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_115741.53.50.x,
DNA sequence
Length = 104
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 449 acccacatgcccatgctcacgtcctccatcttgaacagc 487
|||||||| |||| ||||||||||||||||||||||||
Sbjct: 103 acccacattcccacactcacgtcctccatcttgaacagc 65
>gb|AV560615.1|AV560615 AV560615 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ137f05F 3', mRNA sequence
Length = 350
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
|||||||||||| ||||||||||| || |||||||||||
Sbjct: 255 ctccacccacattcccatgctcacatcttccatcttgaa 293
>gb|BP649393.1|BP649393 BP649393 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-13-H03 3',
mRNA sequence
Length = 397
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
|||||||||||| ||||||||||| || |||||||||||
Sbjct: 337 ctccacccacattcccatgctcacatcttccatcttgaa 375
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
|||||||||||| ||||||||||| || |||||||||||
Sbjct: 9432524 ctccacccacattcccatgctcacatcttccatcttgaa 9432486
>gb|AC008263.2|F25A4 Arabidopsis thaliana chromosome 1 BAC F25A4 sequence, complete sequence
Length = 115721
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 449 acccacatgcccatgctcacgtcctccatcttgaacagc 487
|||||||| |||| ||||||||||||||||||||||||
Sbjct: 72634 acccacattcccacactcacgtcctccatcttgaacagc 72596
>gb|AC000348.2|AC000348 Genomic sequence for Arabidopsis thaliana BAC T7N9 from chromosome I,
complete sequence
Length = 111566
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
|||||||||||| ||||||||||| || |||||||||||
Sbjct: 65376 ctccacccacattcccatgctcacatcttccatcttgaa 65338
>dbj|AK118254.1| Arabidopsis thaliana At1g27120 mRNA for unknown protein, complete
cds, clone: RAFL19-55-I21
Length = 2391
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
|||||||||||| ||||||||||| || |||||||||||
Sbjct: 2066 ctccacccacattcccatgctcacatcttccatcttgaa 2028
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 449 acccacatgcccatgctcacgtcctccatcttgaacagc 487
|||||||| |||| ||||||||||||||||||||||||
Sbjct: 12343715 acccacattcccacactcacgtcctccatcttgaacagc 12343753
>ref|NM_102474.2| Arabidopsis thaliana transferase, transferring glycosyl groups /
transferase, transferring hexosyl groups AT1G27120 mRNA,
complete cds
Length = 2391
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
|||||||||||| ||||||||||| || |||||||||||
Sbjct: 2066 ctccacccacattcccatgctcacatcttccatcttgaa 2028
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 449 acccacatgcccatgctcacgtcctccatcttgaacagc 487
|||||||| |||| ||||||||||||||||||||||||
Sbjct: 28106057 acccacattcccacactcacgtcctccatcttgaacagc 28106095
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
|||||||||||| ||||||||||| || |||||||||||
Sbjct: 9423729 ctccacccacattcccatgctcacatcttccatcttgaa 9423691
>ref|NM_118224.2| Arabidopsis thaliana transferase, transferring glycosyl groups /
transferase, transferring hexosyl groups AT4G21060 mRNA,
complete cds
Length = 2226
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaacagcc 488
||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 2058 ctccacccacaatcccatgctcacatcttccatcttgaatagcc 2015
>emb|AL083949.1|CNS00P1R Arabidopsis thaliana genome survey sequence SP6 end of BAC F7O10 of
IGF library from strain Columbia of Arabidopsis
thaliana, genomic survey sequence
Length = 480
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
||||||||||| ||||||||||| || |||||||||||
Sbjct: 160 ctccacccacaatcccatgctcacatcttccatcttgaa 122
>gb|BZ768878.1|BZ768878 SALK_141126.30.20.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_141126.30.20.x,
DNA sequence
Length = 200
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
||||||||||| ||||||||||| || |||||||||||
Sbjct: 108 ctccacccacaatcccatgctcacatcttccatcttgaa 146
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
||||||||||| ||||||||||| || |||||||||||
Sbjct: 7157452 ctccacccacaatcccatgctcacatcttccatcttgaa 7157414
>emb|AL080282.1|ATT13K14 Arabidopsis thaliana DNA chromosome 4, BAC clone T13K14 (ESSA project)
Length = 91570
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
||||||||||| ||||||||||| || |||||||||||
Sbjct: 83791 ctccacccacaatcccatgctcacatcttccatcttgaa 83753
>emb|AL161554.2|ATCHRIV54 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 54
Length = 198715
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
||||||||||| ||||||||||| || |||||||||||
Sbjct: 56269 ctccacccacaatcccatgctcacatcttccatcttgaa 56231
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaa 483
||||||||||| ||||||||||| || |||||||||||
Sbjct: 11244703 ctccacccacaatcccatgctcacatcttccatcttgaa 11244665
>gb|AU230384.1|AU230384 AU230384 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-55-I21 3',
mRNA sequence
Length = 431
Score = 40.1 bits (20), Expect = 0.39
Identities = 36/40 (90%), Gaps = 1/40 (2%)
Strand = Plus / Plus
Query: 445 ctccacccacatgccc-atgctcacgtcctccatcttgaa 483
|||||||||||| ||| |||||||| || |||||||||||
Sbjct: 322 ctccacccacattccccatgctcacatcttccatcttgaa 361
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 175,208
Number of Sequences: 1013581
Number of extensions: 175208
Number of successful extensions: 13445
Number of sequences better than 0.5: 22
Number of HSP's better than 0.5 without gapping: 22
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 13034
Number of HSP's gapped (non-prelim): 412
length of query: 548
length of database: 908,940,872
effective HSP length: 20
effective length of query: 528
effective length of database: 888,669,252
effective search space: 469217365056
effective search space used: 469217365056
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)