BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QBJ23f06.xg.2.1
         (683 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CL478034.1|CL478034  SAIL_284_C04.v2 SAIL Collection Arab...    40   0.49 
>gb|CL478034.1|CL478034 SAIL_284_C04.v2 SAIL Collection Arabidopsis thaliana genomic clone
           SAIL_284_C04.v2, DNA sequence
          Length = 1312

 Score = 40.1 bits (20), Expect = 0.49
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 10  gcgcgcagcgcgcccgcgca 29
           ||||||||||||||||||||
Sbjct: 177 gcgcgcagcgcgcccgcgca 158
  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 227,978
Number of Sequences: 1013581
Number of extensions: 227978
Number of successful extensions: 15386
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15383
Number of HSP's gapped (non-prelim): 3
length of query: 683
length of database: 908,940,872
effective HSP length: 20
effective length of query: 663
effective length of database: 888,669,252
effective search space: 589187714076
effective search space used: 589187714076
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)