BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBD3a09.xg.3.1
(1105 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BT002376.1| Arabidopsis thaliana unknown protein (At1g17... 50 8e-004
gb|BT009671.1| Arabidopsis thaliana At1g17330 mRNA, complet... 50 8e-004
emb|BX818451.1|CNS0AE1F Arabidopsis thaliana Full-length cD... 50 8e-004
ref|NM_101594.1| Arabidopsis thaliana catalytic AT1G17330 m... 50 8e-004
gb|AV819777.1|AV819777 AV819777 RAFL11 Arabidopsis thaliana... 46 0.013
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 42 0.20
gb|AC007843.6|AC007843 Arabidopsis thaliana chromosome I BA... 42 0.20
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 42 0.20
>gb|BT002376.1| Arabidopsis thaliana unknown protein (At1g17330) mRNA, complete cds
Length = 935
Score = 50.1 bits (25), Expect = 8e-004
Identities = 64/77 (83%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattggggcaattggtattgcaagatgttttacatat 555
|||||||| |||||||| ||||||||||| || || || ||||| | || ||||||| |
Sbjct: 430 caagatgctgatcgccttgatgcaattggcgccataggaattgctcgttgctttacattt 489
Query: 556 ggtggtagcaagaacag 572
||||| |||| ||||||
Sbjct: 490 ggtggaagcaggaacag 506
Score = 46.1 bits (23), Expect = 0.013
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 695 tgatgaagacagaggccgggaaaaggagagctgagaaaaggcataggttcatgga 749
||||||| || ||||| || |||||||| || ||||||||||| | |||||||||
Sbjct: 626 tgatgaaaactgaggcgggtaaaaggagggcagagaaaaggcacaagttcatgga 680
>gb|BT009671.1| Arabidopsis thaliana At1g17330 mRNA, complete cds
Length = 669
Score = 50.1 bits (25), Expect = 8e-004
Identities = 64/77 (83%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattggggcaattggtattgcaagatgttttacatat 555
|||||||| |||||||| ||||||||||| || || || ||||| | || ||||||| |
Sbjct: 373 caagatgctgatcgccttgatgcaattggcgccataggaattgctcgttgctttacattt 432
Query: 556 ggtggtagcaagaacag 572
||||| |||| ||||||
Sbjct: 433 ggtggaagcaggaacag 449
Score = 46.1 bits (23), Expect = 0.013
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 695 tgatgaagacagaggccgggaaaaggagagctgagaaaaggcataggttcatgga 749
||||||| || ||||| || |||||||| || ||||||||||| | |||||||||
Sbjct: 569 tgatgaaaactgaggcgggtaaaaggagggcagagaaaaggcacaagttcatgga 623
>emb|BX818451.1|CNS0AE1F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL79ZG09 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 545
Score = 50.1 bits (25), Expect = 8e-004
Identities = 64/77 (83%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattggggcaattggtattgcaagatgttttacatat 555
|||||||| |||||||| ||||||||||| || || || ||||| | || ||||||| |
Sbjct: 65 caagatgctgatcgccttgatgcaattggcgccataggaattgctcgttgctttacattt 124
Query: 556 ggtggtagcaagaacag 572
||||| |||| ||||||
Sbjct: 125 ggtggaagcaggaacag 141
Score = 46.1 bits (23), Expect = 0.013
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 695 tgatgaagacagaggccgggaaaaggagagctgagaaaaggcataggttcatgga 749
||||||| || ||||| || |||||||| || ||||||||||| | |||||||||
Sbjct: 261 tgatgaaaactgaggcgggtaaaaggagggcagagaaaaggcacaagttcatgga 315
>ref|NM_101594.1| Arabidopsis thaliana catalytic AT1G17330 mRNA, complete cds
Length = 669
Score = 50.1 bits (25), Expect = 8e-004
Identities = 64/77 (83%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattggggcaattggtattgcaagatgttttacatat 555
|||||||| |||||||| ||||||||||| || || || ||||| | || ||||||| |
Sbjct: 373 caagatgctgatcgccttgatgcaattggcgccataggaattgctcgttgctttacattt 432
Query: 556 ggtggtagcaagaacag 572
||||| |||| ||||||
Sbjct: 433 ggtggaagcaggaacag 449
Score = 46.1 bits (23), Expect = 0.013
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 695 tgatgaagacagaggccgggaaaaggagagctgagaaaaggcataggttcatgga 749
||||||| || ||||| || |||||||| || ||||||||||| | |||||||||
Sbjct: 569 tgatgaaaactgaggcgggtaaaaggagggcagagaaaaggcacaagttcatgga 623
>gb|AV819777.1|AV819777 AV819777 RAFL11 Arabidopsis thaliana cDNA clone RAFL11-07-B20 3',
mRNA sequence
Length = 315
Score = 46.1 bits (23), Expect = 0.013
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 695 tgatgaagacagaggccgggaaaaggagagctgagaaaaggcataggttcatgga 749
||||||| || ||||| || |||||||| || ||||||||||| | |||||||||
Sbjct: 310 tgatgaaaactgaggcgggtaaaaggagggcagagaaaaggcacaagttcatgga 256
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 42.1 bits (21), Expect = 0.20
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattgg 524
|||||||| |||||||| |||||||||||
Sbjct: 5930906 caagatgctgatcgccttgatgcaattgg 5930934
>gb|AC007843.6|AC007843 Arabidopsis thaliana chromosome I BAC F28G4 genomic sequence, complete
sequence
Length = 84974
Score = 42.1 bits (21), Expect = 0.20
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 496 caagatgcagatcgcctggatgcaattgg 524
|||||||| |||||||| |||||||||||
Sbjct: 84526 caagatgctgatcgccttgatgcaattgg 84498
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 42.1 bits (21), Expect = 0.20
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattgg 524
|||||||| |||||||| |||||||||||
Sbjct: 5931082 caagatgctgatcgccttgatgcaattgg 5931110
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 565,010
Number of Sequences: 1013581
Number of extensions: 565010
Number of successful extensions: 42664
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42198
Number of HSP's gapped (non-prelim): 466
length of query: 1105
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1085
effective length of database: 888,669,252
effective search space: 964206138420
effective search space used: 964206138420
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)