BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAZ2b01.yg.2.1
(541 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
dbj|AB049934.1| Arabidopsis thaliana mRNA for cytokinin rec... 52 1e-004
dbj|AB049935.1| Arabidopsis thaliana mRNA for cytokinin rec... 52 1e-004
dbj|AB046871.1| Arabidopsis thaliana AHK4 mRNA for histidin... 52 1e-004
emb|AX505345.1| Sequence 40 from Patent WO0216655 52 1e-004
emb|AX537479.1| Sequence 5 from Patent EP1241182 52 1e-004
gb|AC007069.6| Arabidopsis thaliana chromosome 2 clone T23K... 52 1e-004
emb|AJ840030.1| Arabidopsis thaliana T-DNA flanking sequenc... 52 1e-004
emb|AJ278528.1|ATH278528 Arabidopsis thaliana mRNA for puta... 52 1e-004
emb|AJ278529.1|ATH278529 Arabidopsis thaliana mRNA for puta... 52 1e-004
emb|AJ278530.1|ATH278530 Arabidopsis thaliana mRNA for puta... 52 1e-004
emb|CS063639.1| Sequence 1 from Patent EP1522586 52 1e-004
ref|NM_126244.2| Arabidopsis thaliana WOL (CYTOKININ RESPON... 52 1e-004
ref|NM_179594.1| Arabidopsis thaliana WOL (CYTOKININ RESPON... 52 1e-004
ref|NM_201667.1| Arabidopsis thaliana WOL (CYTOKININ RESPON... 52 1e-004
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 52 1e-004
dbj|DD159606.1| Transformed Cell co-expressing both of cyto... 52 1e-004
>dbj|AB049934.1| Arabidopsis thaliana mRNA for cytokinin receptor CRE1a, complete cds
Length = 3649
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1601 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1645
>dbj|AB049935.1| Arabidopsis thaliana mRNA for cytokinin receptor CRE1b, complete cds
Length = 3694
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1638 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1682
>dbj|AB046871.1| Arabidopsis thaliana AHK4 mRNA for histidine kinase, complete cds
Length = 3243
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1570 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1614
>emb|AX505345.1| Sequence 40 from Patent WO0216655
Length = 1803
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 232 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 276
>emb|AX537479.1| Sequence 5 from Patent EP1241182
Length = 3174
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1501 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1545
>gb|AC007069.6| Arabidopsis thaliana chromosome 2 clone T23K3 map mi320, complete
sequence
Length = 73009
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 11452 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 11408
>emb|AJ840030.1| Arabidopsis thaliana T-DNA flanking sequence, right border, clone
543B02
Length = 203
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 96 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 52
>emb|AJ278528.1|ATH278528 Arabidopsis thaliana mRNA for putative histidine kinase receptor (wol
gene), splice variant 1
Length = 3620
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1640 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1684
>emb|AJ278529.1|ATH278529 Arabidopsis thaliana mRNA for putative histidine kinase receptor (wol
gene), splice variant 2
Length = 3503
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1523 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1567
>emb|AJ278530.1|ATH278530 Arabidopsis thaliana mRNA for putative histidine kinase receptor (wol
gene), splice variant 3
Length = 3612
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1632 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1676
>emb|CS063639.1| Sequence 1 from Patent EP1522586
Length = 3174
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1501 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1545
>ref|NM_126244.2| Arabidopsis thaliana WOL (CYTOKININ RESPONSE 1) AT2G01830 (WOL)
transcript variant AT2G01830.1 mRNA, complete cds
Length = 3637
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1635 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1679
>ref|NM_179594.1| Arabidopsis thaliana WOL (CYTOKININ RESPONSE 1) AT2G01830 (WOL)
transcript variant AT2G01830.2 mRNA, complete cds
Length = 3658
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1636 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1680
>ref|NM_201667.1| Arabidopsis thaliana WOL (CYTOKININ RESPONSE 1) AT2G01830 (WOL)
transcript variant AT2G01830.3 mRNA, complete cds
Length = 3654
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1632 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1676
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 365306 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 365262
>dbj|DD159606.1| Transformed Cell co-expressing both of cytokinin receptor and
cytokinin biosynthesizing enzyme
Length = 3174
Score = 52.0 bits (26), Expect = 1e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 12 ttgntaaatgatgtccttgatcgagcaaagattgaagctggaaag 56
||| ||||||| || |||||||| || ||||||||||||||||||
Sbjct: 1501 ttgataaatgaggttcttgatcgcgccaagattgaagctggaaag 1545
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 245,122
Number of Sequences: 1013581
Number of extensions: 245122
Number of successful extensions: 17818
Number of sequences better than 0.5: 16
Number of HSP's better than 0.5 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17695
Number of HSP's gapped (non-prelim): 123
length of query: 541
length of database: 908,940,872
effective HSP length: 20
effective length of query: 521
effective length of database: 888,669,252
effective search space: 462996680292
effective search space used: 462996680292
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)