BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAN24c09.yg.2.1
(425 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CB261308.1|CB261308 08-E9409-012-002-P13-t7r MPIZ-ADIS-0... 74 2e-011
gb|CD534481.1|CD534481 39I11 Arabidopsis Leaf Senescence Li... 74 2e-011
gb|AV442267.1|AV442267 AV442267 Arabidopsis thaliana above-... 74 2e-011
gb|AV550172.1|AV550172 AV550172 Arabidopsis thaliana roots ... 74 2e-011
gb|CK121679.1|CK121679 202d06.p1 AtM1 Arabidopsis thaliana ... 74 2e-011
gb|AF027172.1|AF027172 Arabidopsis thaliana cellulose synth... 74 2e-011
dbj|BD022674.1| Manipulation of cellulose and/or beta-1,4-g... 74 2e-011
dbj|BD022676.1| Manipulation of cellulose and/or beta-1,4-g... 74 2e-011
dbj|BD022679.1| Manipulation of cellulose and/or beta-1,4-g... 74 2e-011
emb|AX030940.1| Sequence 3 from Patent WO9800549 74 2e-011
emb|AX030942.1| Sequence 5 from Patent WO9800549 74 2e-011
emb|AX030948.1| Sequence 11 from Patent WO9800549 74 2e-011
gb|BT008654.1| Arabidopsis thaliana clone RAFL09-89-G08 (R1... 74 2e-011
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 74 2e-011
emb|AJ838254.1| Arabidopsis thaliana T-DNA flanking sequenc... 74 2e-011
emb|AL034567.1|ATF8B4 Arabidopsis thaliana DNA chromosome 4... 74 2e-011
emb|AL161581.2|ATCHRIV77 Arabidopsis thaliana DNA chromosom... 74 2e-011
dbj|AK222115.1| Arabidopsis thaliana mRNA for cellulose syn... 74 2e-011
ref|NM_119393.2| Arabidopsis thaliana CESA1 (CELLULASE SYNT... 74 2e-011
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 74 2e-011
gb|AV536569.1|AV536569 AV536569 Arabidopsis thaliana liquid... 66 5e-009
gb|AF062485.1|AF062485 Arabidopsis thaliana cellulose synth... 66 5e-009
gb|AF375439.1| Arabidopsis thaliana AT5g64740/MVP7_7 mRNA, ... 66 5e-009
emb|AX507835.1| Sequence 2530 from Patent WO0216655 66 5e-009
gb|AY143957.1| Arabidopsis thaliana At5g64740/MVP7_7 mRNA, ... 66 5e-009
emb|BX827280.1|CNS0A2E6 Arabidopsis thaliana Full-length cD... 66 5e-009
dbj|AB025637.1| Arabidopsis thaliana genomic DNA, chromosom... 66 5e-009
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 66 5e-009
ref|NM_125870.2| Arabidopsis thaliana CESA6 (CELLULASE SYNT... 66 5e-009
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 66 5e-009
gb|B24204.1|B24204 F19F17TF IGF Arabidopsis thaliana genomi... 62 8e-008
gb|BH611908.1|BH611908 SALK_031874 Arabidopsis thaliana TDN... 62 8e-008
gb|AC007019.5| Arabidopsis thaliana chromosome 2 clone F7D8... 62 8e-008
ref|NM_127746.1| Arabidopsis thaliana CESA9 (CELLULASE SYNT... 62 8e-008
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 62 8e-008
gb|AV552509.1|AV552509 AV552509 Arabidopsis thaliana roots ... 60 3e-007
gb|BP841009.1|BP841009 BP841009 RAFL19 Arabidopsis thaliana... 56 5e-006
gb|AF091713.1|AF091713 Arabidopsis thaliana cellulose synth... 56 5e-006
gb|AF088917.1|AF088917 Arabidopsis thaliana cellulose synth... 56 5e-006
gb|AY139754.1| Arabidopsis thaliana AT5g17420/T10B6_80 mRNA... 56 5e-006
gb|BT004543.1| Arabidopsis thaliana AT5g17420/T10B6_80 gene... 56 5e-006
emb|AL391142.1|ATT10B6 Arabidopsis thaliana DNA chromosome ... 56 5e-006
dbj|AK220815.1| Arabidopsis thaliana mRNA for cellulose syn... 56 5e-006
ref|NM_121748.2| Arabidopsis thaliana IRX3 (IRREGULAR XYLEM... 56 5e-006
gb|AY136423.1| Arabidopsis thaliana cellulose synthase cata... 52 8e-005
gb|BT008832.1| Arabidopsis thaliana At5g09870 mRNA, complet... 52 8e-005
emb|BX832166.1|CNS0A1ML Arabidopsis thaliana Full-length cD... 52 8e-005
dbj|AB016893.1| Arabidopsis thaliana genomic DNA, chromosom... 52 8e-005
ref|NM_121024.1| Arabidopsis thaliana CESA5 (CELLULASE SYNT... 52 8e-005
gb|AI999519.1|AI999519 701556274 A. thaliana, Columbia Col-... 50 3e-004
gb|CK117572.1|CK117572 215o03.p1 AtM1 Arabidopsis thaliana ... 50 3e-004
gb|CK119314.1|CK119314 204i17.p1 AtM1 Arabidopsis thaliana ... 50 3e-004
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 50 3e-004
dbj|BD022673.1| Manipulation of cellulose and/or beta-1,4-g... 50 3e-004
emb|AX030938.1| Sequence 1 from Patent WO9800549 50 3e-004
gb|AC009525.3| Arabidopsis thaliana chromosome I BAC F22D16... 50 3e-004
gb|AC022521.4|AC022521 Arabidopsis thaliana chromosome I BA... 50 3e-004
ref|NM_100153.2| Arabidopsis thaliana ATCSLD5; cellulose sy... 50 3e-004
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 50 3e-004
emb|AL758408.1| Arabidopsis thaliana T-DNA flanking sequenc... 48 0.001
gb|Z30729.1|Z30729 ATTS2475 Versailles-VB Arabidopsis thali... 48 0.001
gb|AF027174.1|AF027174 Arabidopsis thaliana cellulose synth... 48 0.001
dbj|BD022678.1| Manipulation of cellulose and/or beta-1,4-g... 48 0.001
emb|AX030946.1| Sequence 9 from Patent WO9800549 48 0.001
gb|BT002335.1| Arabidopsis thaliana clone C104938 putative ... 48 0.001
dbj|AB018111.1| Arabidopsis thaliana genomic DNA, chromosom... 48 0.001
ref|NM_120599.2| Arabidopsis thaliana CESA3 (CELLULASE SYNT... 48 0.001
ref|NM_121747.2| Arabidopsis thaliana unknown protein AT5G1... 48 0.001
ref|NM_180507.1| Arabidopsis thaliana unknown protein AT5G1... 48 0.001
gb|AI994106.1|AI994106 701498975 A. thaliana, Ohio State cl... 46 0.005
gb|AF027173.1|AF027173 Arabidopsis thaliana cellulose synth... 46 0.005
gb|AY059858.1| Arabidopsis thaliana cellulose synthase cata... 46 0.005
gb|AY093308.1| Arabidopsis thaliana cellulose synthase cata... 46 0.005
dbj|BD022677.1| Manipulation of cellulose and/or beta-1,4-g... 46 0.005
emb|AX505864.1| Sequence 559 from Patent WO0216655 46 0.005
emb|AX030944.1| Sequence 7 from Patent WO9800549 46 0.005
emb|AL050351.1|ATT22F8 Arabidopsis thaliana DNA chromosome ... 46 0.005
emb|AL161595.2|ATCHRIV91 Arabidopsis thaliana DNA chromosom... 46 0.005
ref|NM_120095.2| Arabidopsis thaliana CESA2; cellulose synt... 46 0.005
gb|AA650885.1|AA650885 30999 Lambda-PRL2 Arabidopsis thalia... 42 0.075
gb|AF458083.1| Arabidopsis thaliana cellulose synthase (IRX... 42 0.075
gb|H36425.1|H36425 14093 Lambda-PRL2 Arabidopsis thaliana c... 40 0.30
gb|AI992524.1|AI992524 701558117 A. thaliana, Ohio State cl... 40 0.30
>gb|CB261308.1|CB261308 08-E9409-012-002-P13-t7r MPIZ-ADIS-012 Arabidopsis thaliana cDNA
clone MPIZp769P132Q 5-PRIME, mRNA sequence
Length = 593
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 315 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 374
Query: 284 g 284
|
Sbjct: 375 g 375
>gb|CD534481.1|CD534481 39I11 Arabidopsis Leaf Senescence Library Arabidopsis thaliana cDNA
3', mRNA sequence
Length = 453
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 224 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 283
Query: 284 g 284
|
Sbjct: 284 g 284
>gb|AV442267.1|AV442267 AV442267 Arabidopsis thaliana above-ground organ two to six-week
old Arabidopsis thaliana cDNA clone APZ12d09_r 5', mRNA
sequence
Length = 433
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 2 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 61
Query: 284 g 284
|
Sbjct: 62 g 62
>gb|AV550172.1|AV550172 AV550172 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ109c04R 5', mRNA sequence
Length = 506
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 421 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 480
Query: 284 g 284
|
Sbjct: 481 g 481
>gb|CK121679.1|CK121679 202d06.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011D06202
5-PRIME, mRNA sequence
Length = 799
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 221 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 280
Query: 284 g 284
|
Sbjct: 281 g 281
>gb|AF027172.1|AF027172 Arabidopsis thaliana cellulose synthase catalytic subunit (RSW1)
gene, complete cds
Length = 8401
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 7148 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 7207
Query: 284 g 284
|
Sbjct: 7208 g 7208
>dbj|BD022674.1| Manipulation of cellulose and/or beta-1,4-glucan
Length = 8411
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 7158 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 7217
Query: 284 g 284
|
Sbjct: 7218 g 7218
>dbj|BD022676.1| Manipulation of cellulose and/or beta-1,4-glucan
Length = 3603
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 2729 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 2788
Query: 284 g 284
|
Sbjct: 2789 g 2789
>dbj|BD022679.1| Manipulation of cellulose and/or beta-1,4-glucan
Length = 3673
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 2799 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 2858
Query: 284 g 284
|
Sbjct: 2859 g 2859
>emb|AX030940.1| Sequence 3 from Patent WO9800549
Length = 8411
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 7158 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 7217
Query: 284 g 284
|
Sbjct: 7218 g 7218
>emb|AX030942.1| Sequence 5 from Patent WO9800549
Length = 3603
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 2729 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 2788
Query: 284 g 284
|
Sbjct: 2789 g 2789
>emb|AX030948.1| Sequence 11 from Patent WO9800549
Length = 3673
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 2799 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 2858
Query: 284 g 284
|
Sbjct: 2859 g 2859
>gb|BT008654.1| Arabidopsis thaliana clone RAFL09-89-G08 (R19778) putative cellulose
synthase catalytic subunit (RSW1) (At4g32410) mRNA,
complete cds
Length = 3763
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 2873 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 2932
Query: 284 g 284
|
Sbjct: 2933 g 2933
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Minus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 11554307 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 11554248
Query: 284 g 284
|
Sbjct: 11554247 g 11554247
Score = 46.1 bits (23), Expect = 0.005
Identities = 59/71 (83%)
Strand = Plus / Plus
Query: 247 gatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttc 306
|||||||||||||| || |||||||| ||||| || ||||| | |||||||| || ||
Sbjct: 14214193 gatgattggtggagaaacgagcagttttgggtaatcggaggggcctcctcgcatctattt 14214252
Query: 307 gctgtgtttca 317
||| |||||||
Sbjct: 14214253 gctctgtttca 14214263
>emb|AJ838254.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
355C10
Length = 556
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 346 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 405
Query: 284 g 284
|
Sbjct: 406 g 406
>emb|AL034567.1|ATF8B4 Arabidopsis thaliana DNA chromosome 4, BAC clone F8B4 (ESSA project)
Length = 93257
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Minus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 41818 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 41759
Query: 284 g 284
|
Sbjct: 41758 g 41758
>emb|AL161581.2|ATCHRIV77 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 77
Length = 197252
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Minus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 55535 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 55476
Query: 284 g 284
|
Sbjct: 55475 g 55475
>dbj|AK222115.1| Arabidopsis thaliana mRNA for cellulose synthase catalytic subunit,
complete cds, clone: RAFL22-92-A12
Length = 1456
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 602 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 661
Query: 284 g 284
|
Sbjct: 662 g 662
>ref|NM_119393.2| Arabidopsis thaliana CESA1 (CELLULASE SYNTHASE 1); transferase,
transferring glycosyl groups AT4G32410 (CESA1) mRNA,
complete cds
Length = 3912
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 3006 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 3065
Query: 284 g 284
|
Sbjct: 3066 g 3066
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 73.8 bits (37), Expect = 2e-011
Identities = 55/61 (90%)
Strand = Plus / Minus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 15641532 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctgggtcattg 15641473
Query: 284 g 284
|
Sbjct: 15641472 g 15641472
Score = 46.1 bits (23), Expect = 0.005
Identities = 59/71 (83%)
Strand = Plus / Plus
Query: 247 gatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttc 306
|||||||||||||| || |||||||| ||||| || ||||| | |||||||| || ||
Sbjct: 18301393 gatgattggtggagaaacgagcagttttgggtaatcggaggggcctcctcgcatctattt 18301452
Query: 307 gctgtgtttca 317
||| |||||||
Sbjct: 18301453 gctctgtttca 18301463
>gb|AV536569.1|AV536569 AV536569 Arabidopsis thaliana liquid-cultured seedlings Columbia
Arabidopsis thaliana cDNA clone pAZNII0292R 5', mRNA
sequence
Length = 396
Score = 65.9 bits (33), Expect = 5e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 238 gttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
|||||||| |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 220 gttgggatcgatgattggtggagaaacgaacagttttgggtcattggaggtgt 272
>gb|AF062485.1|AF062485 Arabidopsis thaliana cellulose synthase mRNA, partial cds
Length = 3444
Score = 65.9 bits (33), Expect = 5e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 238 gttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
|||||||| |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 2750 gttgggatcgatgattggtggagaaacgaacagttttgggtcattggaggtgt 2802
>gb|AF375439.1| Arabidopsis thaliana AT5g64740/MVP7_7 mRNA, complete cds
Length = 1492
Score = 65.9 bits (33), Expect = 5e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 238 gttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
|||||||| |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 850 gttgggatcgatgattggtggagaaacgaacagttttgggtcattggaggtgt 902
>emb|AX507835.1| Sequence 2530 from Patent WO0216655
Length = 3255
Score = 65.9 bits (33), Expect = 5e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 238 gttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
|||||||| |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 2758 gttgggatcgatgattggtggagaaacgaacagttttgggtcattggaggtgt 2810
>gb|AY143957.1| Arabidopsis thaliana At5g64740/MVP7_7 mRNA, complete cds
Length = 1101
Score = 65.9 bits (33), Expect = 5e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 238 gttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
|||||||| |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 604 gttgggatcgatgattggtggagaaacgaacagttttgggtcattggaggtgt 656
>emb|BX827280.1|CNS0A2E6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS32ZA11 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 832
Score = 65.9 bits (33), Expect = 5e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 244 attgatgattggtggaggaatgagcagttctgggtcattgg 284
||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 5 attgaggattggtggaggaacgagcagttctgggtcattgg 45
>dbj|AB025637.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MVP7
Length = 39645
Score = 65.9 bits (33), Expect = 5e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 238 gttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
|||||||| |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 22816 gttgggatcgatgattggtggagaaacgaacagttttgggtcattggaggtgt 22868
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 65.9 bits (33), Expect = 5e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 238 gttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
|||||||| |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 22911149 gttgggatcgatgattggtggagaaacgaacagttttgggtcattggaggtgt 22911201
Score = 56.0 bits (28), Expect = 5e-006
Identities = 55/64 (85%)
Strand = Plus / Minus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| || ||| | ||||| || |||||||| || ||||| |||||||||||||
Sbjct: 5490345 tgagatggagcggagttagcattgaggaatggtggagaaacgagcaattctgggtcattg 5490286
Query: 284 gagg 287
||||
Sbjct: 5490285 gagg 5490282
Score = 52.0 bits (26), Expect = 8e-005
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 241 gggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| |||||||||||||| || || ||||| ||||| |||||||||||
Sbjct: 2896566 gggatcgatgattggtggagaaacgaacagttttgggtgattggaggtgt 2896615
Score = 48.1 bits (24), Expect = 0.001
Identities = 78/96 (81%)
Strand = Plus / Minus
Query: 222 aatgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcat 281
|||||| |||||||| || || || || || |||||||| || |||||||| ||||||||
Sbjct: 1459955 aatgaggtggagtggcgtaggcatagacgaatggtggagaaacgagcagttttgggtcat 1459896
Query: 282 tggaggtgtgtcctcgcacctcttcgctgtgtttca 317
||| || || ||| | || | ||||||||||||||
Sbjct: 1459895 tggtggagtatccgctcatttattcgctgtgtttca 1459860
>ref|NM_125870.2| Arabidopsis thaliana CESA6 (CELLULASE SYNTHASE 6); transferase,
transferring glycosyl groups AT5G64740 (CESA6) mRNA,
complete cds
Length = 4105
Score = 65.9 bits (33), Expect = 5e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 238 gttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
|||||||| |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 3247 gttgggatcgatgattggtggagaaacgaacagttttgggtcattggaggtgt 3299
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 65.9 bits (33), Expect = 5e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 238 gttgggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
|||||||| |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 25903062 gttgggatcgatgattggtggagaaacgaacagttttgggtcattggaggtgt 25903114
Score = 56.0 bits (28), Expect = 5e-006
Identities = 55/64 (85%)
Strand = Plus / Minus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| || ||| | ||||| || |||||||| || ||||| |||||||||||||
Sbjct: 5737372 tgagatggagcggagttagcattgaggaatggtggagaaacgagcaattctgggtcattg 5737313
Query: 284 gagg 287
||||
Sbjct: 5737312 gagg 5737309
Score = 52.0 bits (26), Expect = 8e-005
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 241 gggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| |||||||||||||| || || ||||| ||||| |||||||||||
Sbjct: 3077481 gggatcgatgattggtggagaaacgaacagttttgggtgattggaggtgt 3077530
Score = 48.1 bits (24), Expect = 0.001
Identities = 78/96 (81%)
Strand = Plus / Minus
Query: 222 aatgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcat 281
|||||| |||||||| || || || || || |||||||| || |||||||| ||||||||
Sbjct: 1530918 aatgaggtggagtggcgtaggcatagacgaatggtggagaaacgagcagttttgggtcat 1530859
Query: 282 tggaggtgtgtcctcgcacctcttcgctgtgtttca 317
||| || || ||| | || | ||||||||||||||
Sbjct: 1530858 tggtggagtatccgctcatttattcgctgtgtttca 1530823
>gb|B24204.1|B24204 F19F17TF IGF Arabidopsis thaliana genomic clone F19F17, DNA
sequence
Length = 598
Score = 61.9 bits (31), Expect = 8e-008
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 247 gatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttc 306
|||||||||||||| || |||||||| |||||||||||||| || || ||||| || ||
Sbjct: 117 gatgattggtggagaaacgagcagttttgggtcattggaggagtctcttcgcatctattt 58
Query: 307 gctgtgtttca 317
||| |||||||
Sbjct: 57 gctctgtttca 47
>gb|BH611908.1|BH611908 SALK_031874 Arabidopsis thaliana TDNA insertion lines Arabidopsis
thaliana genomic clone SALK_031874, DNA sequence
Length = 212
Score = 61.9 bits (31), Expect = 8e-008
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 247 gatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttc 306
|||||||||||||| || |||||||| |||||||||||||| || || ||||| || ||
Sbjct: 23 gatgattggtggagaaacgagcagttttgggtcattggaggagtctcttcgcatctattt 82
Query: 307 gctgtgtttca 317
||| |||||||
Sbjct: 83 gctctgtttca 93
>gb|AC007019.5| Arabidopsis thaliana chromosome 2 clone F7D8 map mi238, complete
sequence
Length = 107848
Score = 61.9 bits (31), Expect = 8e-008
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 247 gatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttc 306
|||||||||||||| || |||||||| |||||||||||||| || || ||||| || ||
Sbjct: 19927 gatgattggtggagaaacgagcagttttgggtcattggaggagtctcttcgcatctattt 19986
Query: 307 gctgtgtttca 317
||| |||||||
Sbjct: 19987 gctctgtttca 19997
>ref|NM_127746.1| Arabidopsis thaliana CESA9 (CELLULASE SYNTHASE 9); transferase,
transferring glycosyl groups AT2G21770 (CESA9) mRNA,
complete cds
Length = 3308
Score = 61.9 bits (31), Expect = 8e-008
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 247 gatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttc 306
|||||||||||||| || |||||||| |||||||||||||| || || ||||| || ||
Sbjct: 2776 gatgattggtggagaaacgagcagttttgggtcattggaggagtctcttcgcatctattt 2835
Query: 307 gctgtgtttca 317
||| |||||||
Sbjct: 2836 gctctgtttca 2846
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 61.9 bits (31), Expect = 8e-008
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 247 gatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttc 306
|||||||||||||| || |||||||| |||||||||||||| || || ||||| || ||
Sbjct: 9296084 gatgattggtggagaaacgagcagttttgggtcattggaggagtctcttcgcatctattt 9296143
Query: 307 gctgtgtttca 317
||| |||||||
Sbjct: 9296144 gctctgtttca 9296154
>gb|AV552509.1|AV552509 AV552509 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ31f05R 5', mRNA sequence
Length = 496
Score = 60.0 bits (30), Expect = 3e-007
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctggg 277
|||||||||| ||||| | ||||| |||||||||||||| |||||||||||||
Sbjct: 443 tgagatggagcggtgtgagcattgaggattggtggaggaacgagcagttctggg 496
>gb|BP841009.1|BP841009 BP841009 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-31-O12 5',
mRNA sequence
Length = 393
Score = 56.0 bits (28), Expect = 5e-006
Identities = 55/64 (85%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| || ||| | ||||| || |||||||| || ||||| |||||||||||||
Sbjct: 245 tgagatggagcggagttagcattgaggaatggtggagaaacgagcaattctgggtcattg 304
Query: 284 gagg 287
||||
Sbjct: 305 gagg 308
>gb|AF091713.1|AF091713 Arabidopsis thaliana cellulose synthase catalytic subunit (IRX3)
gene, complete cds
Length = 7234
Score = 56.0 bits (28), Expect = 5e-006
Identities = 55/64 (85%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| || ||| | ||||| || |||||||| || ||||| |||||||||||||
Sbjct: 4129 tgagatggagcggagttagcattgaggaatggtggagaaacgagcaattctgggtcattg 4188
Query: 284 gagg 287
||||
Sbjct: 4189 gagg 4192
>gb|AF088917.1|AF088917 Arabidopsis thaliana cellulose synthase catalytic subunit (IRX3)
mRNA, complete cds
Length = 3081
Score = 56.0 bits (28), Expect = 5e-006
Identities = 55/64 (85%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| || ||| | ||||| || |||||||| || ||||| |||||||||||||
Sbjct: 2570 tgagatggagcggagttagcattgaggaatggtggagaaacgagcaattctgggtcattg 2629
Query: 284 gagg 287
||||
Sbjct: 2630 gagg 2633
>gb|AY139754.1| Arabidopsis thaliana AT5g17420/T10B6_80 mRNA, complete cds
Length = 3355
Score = 56.0 bits (28), Expect = 5e-006
Identities = 55/64 (85%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| || ||| | ||||| || |||||||| || ||||| |||||||||||||
Sbjct: 2615 tgagatggagcggagttagcattgaggaatggtggagaaacgagcaattctgggtcattg 2674
Query: 284 gagg 287
||||
Sbjct: 2675 gagg 2678
>gb|BT004543.1| Arabidopsis thaliana AT5g17420/T10B6_80 gene, complete cds
Length = 3081
Score = 56.0 bits (28), Expect = 5e-006
Identities = 55/64 (85%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| || ||| | ||||| || |||||||| || ||||| |||||||||||||
Sbjct: 2570 tgagatggagcggagttagcattgaggaatggtggagaaacgagcaattctgggtcattg 2629
Query: 284 gagg 287
||||
Sbjct: 2630 gagg 2633
>emb|AL391142.1|ATT10B6 Arabidopsis thaliana DNA chromosome 5, BAC clone T10B6 (ESSA project)
Length = 33563
Score = 56.0 bits (28), Expect = 5e-006
Identities = 55/64 (85%)
Strand = Plus / Minus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| || ||| | ||||| || |||||||| || ||||| |||||||||||||
Sbjct: 21174 tgagatggagcggagttagcattgaggaatggtggagaaacgagcaattctgggtcattg 21115
Query: 284 gagg 287
||||
Sbjct: 21114 gagg 21111
>dbj|AK220815.1| Arabidopsis thaliana mRNA for cellulose synthase catalytic subunit,
partial cds, clone: RAFL22-31-O12
Length = 930
Score = 56.0 bits (28), Expect = 5e-006
Identities = 55/64 (85%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| || ||| | ||||| || |||||||| || ||||| |||||||||||||
Sbjct: 245 tgagatggagcggagttagcattgaggaatggtggagaaacgagcaattctgggtcattg 304
Query: 284 gagg 287
||||
Sbjct: 305 gagg 308
>ref|NM_121748.2| Arabidopsis thaliana IRX3 (IRREGULAR XYLEM 3); cellulose synthase
AT5G17420 (IRX3) mRNA, complete cds
Length = 3693
Score = 56.0 bits (28), Expect = 5e-006
Identities = 55/64 (85%)
Strand = Plus / Plus
Query: 224 tgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattg 283
|||||||||| || ||| | ||||| || |||||||| || ||||| |||||||||||||
Sbjct: 2615 tgagatggagcggagttagcattgaggaatggtggagaaacgagcaattctgggtcattg 2674
Query: 284 gagg 287
||||
Sbjct: 2675 gagg 2678
>gb|AY136423.1| Arabidopsis thaliana cellulose synthase catalytic subunit
(At5g09870) mRNA, complete cds
Length = 1490
Score = 52.0 bits (26), Expect = 8e-005
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 241 gggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| |||||||||||||| || || ||||| ||||| |||||||||||
Sbjct: 706 gggatcgatgattggtggagaaacgaacagttttgggtgattggaggtgt 755
>gb|BT008832.1| Arabidopsis thaliana At5g09870 mRNA, complete cds
Length = 1041
Score = 52.0 bits (26), Expect = 8e-005
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 241 gggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| |||||||||||||| || || ||||| ||||| |||||||||||
Sbjct: 547 gggatcgatgattggtggagaaacgaacagttttgggtgattggaggtgt 596
>emb|BX832166.1|CNS0A1ML Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH56ZA06 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 3911
Score = 52.0 bits (26), Expect = 8e-005
Identities = 48/54 (88%), Gaps = 1/54 (1%)
Strand = Plus / Plus
Query: 238 gttgggattgatgattggtggaggaatgagcagttct-gggtcattggaggtgt 290
|||||||| |||||||||||||| || || ||||| | ||||||||||||||||
Sbjct: 3186 gttgggatcgatgattggtggagaaacgaacagttttggggtcattggaggtgt 3239
>dbj|AB016893.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYH9
Length = 82390
Score = 52.0 bits (26), Expect = 8e-005
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 241 gggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| |||||||||||||| || || ||||| ||||| |||||||||||
Sbjct: 30244 gggatcgatgattggtggagaaacgaacagttttgggtgattggaggtgt 30293
>ref|NM_121024.1| Arabidopsis thaliana CESA5 (CELLULASE SYNTHASE 5); transferase,
transferring glycosyl groups AT5G09870 (CESA5) mRNA,
complete cds
Length = 3210
Score = 52.0 bits (26), Expect = 8e-005
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 241 gggattgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| |||||||||||||| || || ||||| ||||| |||||||||||
Sbjct: 2716 gggatcgatgattggtggagaaacgaacagttttgggtgattggaggtgt 2765
>gb|AI999519.1|AI999519 701556274 A. thaliana, Columbia Col-0, rosette-3 Arabidopsis
thaliana cDNA clone 701556274, mRNA sequence
Length = 613
Score = 50.1 bits (25), Expect = 3e-004
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 247 gatgattggtggaggaatgagcagttctgggtcattggaggtgtgtcctcgcacctcttc 306
|||||| ||||||| | |||||||| |||||||||||||| || || ||||| || ||
Sbjct: 530 gatgatnggtggagaancgagcagttttgggtcattggaggagtctcttcgcatctattt 471
Query: 307 gctgtgtttca 317
||| |||||||
Sbjct: 470 gctctgtttca 460
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 305,425
Number of Sequences: 1013581
Number of extensions: 305425
Number of successful extensions: 26309
Number of sequences better than 0.5: 83
Number of HSP's better than 0.5 without gapping: 87
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24502
Number of HSP's gapped (non-prelim): 1796
length of query: 425
length of database: 908,940,872
effective HSP length: 20
effective length of query: 405
effective length of database: 888,669,252
effective search space: 359911047060
effective search space used: 359911047060
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)