BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF30a10.yg.2.1
(1130 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC002062.1|F20P5 Sequence of BAC F20P5 from Arabidopsis ... 44 0.052
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 44 0.052
ref|NM_105681.1| Arabidopsis thaliana kinase AT1G70130 mRNA... 44 0.052
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 44 0.052
emb|AL081762.1|CNS00ND0 Arabidopsis thaliana genome survey ... 42 0.21
gb|BZ769774.1|BZ769774 SALK_142707.50.75.x Arabidopsis thal... 42 0.21
gb|CL505165.1|CL505165 SAIL_747_A08.v1 SAIL Collection Arab... 42 0.21
gb|T22574.1|T22574 4582 Lambda-PRL2 Arabidopsis thaliana cD... 42 0.21
gb|BX835463.1|BX835463 BX835463 Arabidopsis thaliana Adult ... 42 0.21
gb|BX836186.1|BX836186 BX836186 Arabidopsis thaliana Hormon... 42 0.21
gb|AV536501.1|AV536501 AV536501 Arabidopsis thaliana liquid... 42 0.21
gb|CB254152.1|CB254152 78-E018360-019-007-K19-T7R MPIZ-ADIS... 42 0.21
gb|AF162444.1|T32N4 Arabidopsis thaliana BAC T32N4 42 0.21
emb|AX059537.1| Sequence 270 from Patent WO0055325 42 0.21
gb|AY064972.1| Arabidopsis thaliana AT4g08850/T32A17_160 mR... 42 0.21
gb|BT005677.1| Arabidopsis thaliana clone U50474 putative p... 42 0.21
gb|BT008663.1| Arabidopsis thaliana clone RAFL16-97-D11 (R5... 42 0.21
gb|AC004697.3| Arabidopsis thaliana chromosome 2 clone T16B... 42 0.21
emb|BX831171.1|CNS0A0QB Arabidopsis thaliana Full-length cD... 42 0.21
emb|BX830638.1|CNS0A1GA Arabidopsis thaliana Full-length cD... 42 0.21
emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, shor... 42 0.21
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 42 0.21
dbj|AB025609.1| Arabidopsis thaliana genomic DNA, chromosom... 42 0.21
dbj|AB026639.1| Arabidopsis thaliana genomic DNA, chromosom... 42 0.21
dbj|AK117556.1| Arabidopsis thaliana At5g47070 mRNA for put... 42 0.21
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 42 0.21
gb|AY772638.1| Arabidopsis thaliana voucher CS902 SRK (SRK)... 42 0.21
gb|AY772644.1| Arabidopsis thaliana voucher CS902 SRK (SRK)... 42 0.21
emb|AL161502.2|ATCHRIV14 Arabidopsis thaliana DNA chromosom... 42 0.21
emb|AL161513.2|ATCHRIV25 Arabidopsis thaliana DNA chromosom... 42 0.21
emb|AL161813.1|ATT32A17 Arabidopsis thaliana DNA chromosome... 42 0.21
ref|NM_116735.2| Arabidopsis thaliana kinase AT4G04960 mRNA... 42 0.21
ref|NM_179207.1| Arabidopsis thaliana kinase AT4G08850 tran... 42 0.21
ref|NM_116955.3| Arabidopsis thaliana unknown protein AT4G0... 42 0.21
ref|NM_129475.2| Arabidopsis thaliana ATP binding / kinase/... 42 0.21
ref|NM_124078.2| Arabidopsis thaliana ATP binding / kinase/... 42 0.21
ref|NM_105693.2| Arabidopsis thaliana ATP binding / protein... 42 0.21
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 42 0.21
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 42 0.21
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 42 0.21
>gb|AC002062.1|F20P5 Sequence of BAC F20P5 from Arabidopsis thaliana chromosome 1, complete
sequence
Length = 114505
Score = 44.1 bits (22), Expect = 0.052
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 830 tgatatttttgcttttggtgtggtcatgttggagatta 867
|||| ||||||| ||||| ||| |||||||||||||||
Sbjct: 52522 tgatgtttttgcatttggagtgttcatgttggagatta 52559
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 698 ccctaagatttcggatttcgg 718
|||||||||||||||||||||
Sbjct: 7212 ccctaagatttcggatttcgg 7192
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 44.1 bits (22), Expect = 0.052
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 830 tgatatttttgcttttggtgtggtcatgttggagatta 867
|||| ||||||| ||||| ||| |||||||||||||||
Sbjct: 10651481 tgatgtttttgcatttggagtgttcatgttggagatta 10651444
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 698 ccctaagatttcggatttcgg 718
|||||||||||||||||||||
Sbjct: 10696791 ccctaagatttcggatttcgg 10696811
>ref|NM_105681.1| Arabidopsis thaliana kinase AT1G70130 mRNA, complete cds
Length = 1971
Score = 44.1 bits (22), Expect = 0.052
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 830 tgatatttttgcttttggtgtggtcatgttggagatta 867
|||| ||||||| ||||| ||| |||||||||||||||
Sbjct: 1548 tgatgtttttgcatttggagtgttcatgttggagatta 1585
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 44.1 bits (22), Expect = 0.052
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 830 tgatatttttgcttttggtgtggtcatgttggagatta 867
|||| ||||||| ||||| ||| |||||||||||||||
Sbjct: 26413829 tgatgtttttgcatttggagtgttcatgttggagatta 26413792
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 698 ccctaagatttcggatttcgg 718
|||||||||||||||||||||
Sbjct: 26459139 ccctaagatttcggatttcgg 26459159
>emb|AL081762.1|CNS00ND0 Arabidopsis thaliana genome survey sequence T7 end of BAC F3K2 of
IGF library from strain Columbia of Arabidopsis
thaliana, genomic survey sequence
Length = 407
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 332 cttttggtttatgagtacatg 352
>gb|BZ769774.1|BZ769774 SALK_142707.50.75.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_142707.50.75.x,
DNA sequence
Length = 167
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 698 ccctaagatttcggatttcgg 718
|||||||||||||||||||||
Sbjct: 135 ccctaagatttcggatttcgg 155
>gb|CL505165.1|CL505165 SAIL_747_A08.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_747_A08.v1, DNA sequence
Length = 938
Score = 42.1 bits (21), Expect = 0.21
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 473 ttgccttgagggaaataaaccactt 497
|||| ||||||||||||||||||||
Sbjct: 383 ttgctttgagggaaataaaccactt 407
>gb|T22574.1|T22574 4582 Lambda-PRL2 Arabidopsis thaliana cDNA clone 98M16T7, mRNA
sequence
Length = 324
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 499 tggtttatgagtacatggagagtggaagc 527
||||||| |||||||||||||| ||||||
Sbjct: 138 tggtttacgagtacatggagagaggaagc 166
>gb|BX835463.1|BX835463 BX835463 Arabidopsis thaliana Adult vegetative tissue Col-0
Arabidopsis thaliana cDNA clone GSLTLS12ZG02 3PRIM, mRNA
sequence
Length = 1025
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 499 tggtttatgagtacatggagagtggaagc 527
||||||| |||||||||||||| ||||||
Sbjct: 719 tggtttacgagtacatggagagaggaagc 691
>gb|BX836186.1|BX836186 BX836186 Arabidopsis thaliana Hormone Treated Callus Col-0
Arabidopsis thaliana cDNA clone GSLTPGH35ZE08 3PRIM,
mRNA sequence
Length = 1046
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 499 tggtttatgagtacatggagagtggaagc 527
||||||| |||||||||||||| ||||||
Sbjct: 698 tggtttacgagtacatggagagaggaagc 670
>gb|AV536501.1|AV536501 AV536501 Arabidopsis thaliana liquid-cultured seedlings Columbia
Arabidopsis thaliana cDNA clone pAZNII0214R 5', mRNA
sequence
Length = 270
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 184 cttttggtttatgagtacatg 204
>gb|CB254152.1|CB254152 78-E018360-019-007-K19-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768K197Q 5-PRIME, mRNA sequence
Length = 662
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 498 ttggtttatgagtacatggagagtggaag 526
||||||||||| |||||||||| ||||||
Sbjct: 99 ttggtttatgattacatggagaatggaag 127
>gb|AF162444.1|T32N4 Arabidopsis thaliana BAC T32N4
Length = 80196
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 498 ttggtttatgagtacatggagagtggaag 526
||||||||||| |||||||||| ||||||
Sbjct: 4843 ttggtttatgattacatggagaatggaag 4871
>emb|AX059537.1| Sequence 270 from Patent WO0055325
Length = 49885
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 498 ttggtttatgagtacatggagagtggaag 526
||||||||||| |||||||||| ||||||
Sbjct: 45231 ttggtttatgattacatggagaatggaag 45259
>gb|AY064972.1| Arabidopsis thaliana AT4g08850/T32A17_160 mRNA, complete cds
Length = 3342
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 499 tggtttatgagtacatggagagtggaagc 527
||||||| |||||||||||||| ||||||
Sbjct: 2552 tggtttacgagtacatggagagaggaagc 2580
>gb|BT005677.1| Arabidopsis thaliana clone U50474 putative protein serine threonine
kinase (At5g47070) mRNA, complete cds
Length = 1264
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 499 cttttggtttatgagtacatg 519
>gb|BT008663.1| Arabidopsis thaliana clone RAFL16-97-D11 (R50243) putative protein
kinase (At4g04960) mRNA, complete cds
Length = 2318
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 498 ttggtttatgagtacatggagagtggaag 526
||||||||||| |||||||||| ||||||
Sbjct: 1298 ttggtttatgattacatggagaatggaag 1326
>gb|AC004697.3| Arabidopsis thaliana chromosome 2 clone T16B24 map CIC10A06, complete
sequence
Length = 113950
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 93250 cttttggtttatgagtacatg 93270
>emb|BX831171.1|CNS0A0QB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS64ZB02 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1545
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 686 cttttggtttatgagtacatg 706
>emb|BX830638.1|CNS0A1GA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB95ZH05 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1520
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 679 cttttggtttatgagtacatg 699
>emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, short arm
Length = 3052119
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 498 ttggtttatgagtacatggagagtggaag 526
||||||||||| |||||||||| ||||||
Sbjct: 2533171 ttggtttatgattacatggagaatggaag 2533199
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 499 tggtttatgagtacatggagagtggaagc 527
||||||| |||||||||||||| ||||||
Sbjct: 1550657 tggtttacgagtacatggagagaggaagc 1550629
>dbj|AB025609.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K14A3
Length = 34498
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 2578 cttttggtttatgagtacatg 2558
>dbj|AB026639.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L13
Length = 63921
Score = 42.1 bits (21), Expect = 0.21
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 473 ttgccttgagggaaataaaccactt 497
|||| ||||||||||||||||||||
Sbjct: 55438 ttgctttgagggaaataaaccactt 55462
>dbj|AK117556.1| Arabidopsis thaliana At5g47070 mRNA for putative protein
serine/threonine kinase, complete cds, clone:
RAFL17-20-O04
Length = 1756
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 882 cttttggtttatgagtacatg 902
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 42.1 bits (21), Expect = 0.21
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 473 ttgccttgagggaaataaaccactt 497
|||| ||||||||||||||||||||
Sbjct: 23207208 ttgctttgagggaaataaaccactt 23207232
>gb|AY772638.1| Arabidopsis thaliana voucher CS902 SRK (SRK) pseudogene, complete cds
Length = 4381
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 504 tatgagtacatggagagtggaagccttga 532
||||||||| |||||| ||||||||||||
Sbjct: 3224 tatgagtacttggagaatggaagccttga 3252
>gb|AY772644.1| Arabidopsis thaliana voucher CS902 SRK (SRK) pseudogene mRNA,
complete sequence
Length = 2719
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 504 tatgagtacatggagagtggaagccttga 532
||||||||| |||||| ||||||||||||
Sbjct: 1822 tatgagtacttggagaatggaagccttga 1850
>emb|AL161502.2|ATCHRIV14 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 14
Length = 198563
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 498 ttggtttatgagtacatggagagtggaag 526
||||||||||| |||||||||| ||||||
Sbjct: 66368 ttggtttatgattacatggagaatggaag 66396
>emb|AL161513.2|ATCHRIV25 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 25
Length = 179771
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 499 tggtttatgagtacatggagagtggaagc 527
||||||| |||||||||||||| ||||||
Sbjct: 25083 tggtttacgagtacatggagagaggaagc 25055
>emb|AL161813.1|ATT32A17 Arabidopsis thaliana DNA chromosome 4, BAC clone T32A17 (ESSA project)
Length = 104386
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 499 tggtttatgagtacatggagagtggaagc 527
||||||| |||||||||||||| ||||||
Sbjct: 95173 tggtttacgagtacatggagagaggaagc 95145
>ref|NM_116735.2| Arabidopsis thaliana kinase AT4G04960 mRNA, complete cds
Length = 2303
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 498 ttggtttatgagtacatggagagtggaag 526
||||||||||| |||||||||| ||||||
Sbjct: 1298 ttggtttatgattacatggagaatggaag 1326
>ref|NM_179207.1| Arabidopsis thaliana kinase AT4G08850 transcript variant AT4G08850.1
mRNA, complete cds
Length = 3482
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 499 tggtttatgagtacatggagagtggaagc 527
||||||| |||||||||||||| ||||||
Sbjct: 2692 tggtttacgagtacatggagagaggaagc 2720
>ref|NM_116955.3| Arabidopsis thaliana unknown protein AT4G08850 transcript variant
AT4G08850.2 mRNA, complete cds
Length = 3299
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 499 tggtttatgagtacatggagagtggaagc 527
||||||| |||||||||||||| ||||||
Sbjct: 2692 tggtttacgagtacatggagagaggaagc 2720
>ref|NM_129475.2| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
serine/threonine kinase/ protein-tyrosine kinase
AT2G39180 mRNA, complete cds
Length = 2442
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 1771 cttttggtttatgagtacatg 1791
>ref|NM_124078.2| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
serine/threonine kinase/ protein-tyrosine kinase
AT5G47070 mRNA, complete cds
Length = 1754
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 880 cttttggtttatgagtacatg 900
>ref|NM_105693.2| Arabidopsis thaliana ATP binding / protein kinase/ protein
serine/threonine kinase/ protein-tyrosine kinase/
transmembrane receptor protein serine/t> AT1G70250 mRNA,
complete cds
Length = 2410
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 698 ccctaagatttcggatttcgg 718
|||||||||||||||||||||
Sbjct: 1798 ccctaagatttcggatttcgg 1818
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 16351916 cttttggtttatgagtacatg 16351896
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 499 tggtttatgagtacatggagagtggaagc 527
||||||| |||||||||||||| ||||||
Sbjct: 5637942 tggtttacgagtacatggagagaggaagc 5637914
Score = 42.1 bits (21), Expect = 0.21
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 498 ttggtttatgagtacatggagagtggaag 526
||||||||||| |||||||||| ||||||
Sbjct: 2534351 ttggtttatgattacatggagaatggaag 2534379
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 42.1 bits (21), Expect = 0.21
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 473 ttgccttgagggaaataaaccactt 497
|||| ||||||||||||||||||||
Sbjct: 26256361 ttgctttgagggaaataaaccactt 26256385
Score = 42.1 bits (21), Expect = 0.21
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 19136965 cttttggtttatgagtacatg 19136945
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 545,074
Number of Sequences: 1013581
Number of extensions: 545074
Number of successful extensions: 40710
Number of sequences better than 0.5: 41
Number of HSP's better than 0.5 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38459
Number of HSP's gapped (non-prelim): 2251
length of query: 1130
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1110
effective length of database: 888,669,252
effective search space: 986422869720
effective search space used: 986422869720
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)