BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 8636641.2.1
         (1326 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AE005172.1|  Arabidopsis thaliana chromosome 1, top arm c...    50   0.001
gb|AC010657.3|AC010657  Genomic sequence for Arabidopsis tha...    50   0.001
gb|AC012188.2|F14L17  Sequence of BAC F14L17 from Arabidopsi...    50   0.001
ref|NM_101322.1|  Arabidopsis thaliana peroxidase AT1G14550 ...    50   0.001
ref|NC_003070.5|  Arabidopsis thaliana chromosome 1, complet...    50   0.001
emb|BX657692.1|  Arabidopsis thaliana T-DNA flanking sequenc...    44   0.061
gb|BP603773.1|BP603773  BP603773 RAFL16 Arabidopsis thaliana...    44   0.061

>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
          Length = 14221815

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 176     atccgcatgcacttccatgactgctttgt 204
               ||||||||||||||||||||||| |||||
Sbjct: 4979027 atccgcatgcacttccatgactgttttgt 4979055



>gb|AC010657.3|AC010657 Genomic sequence for Arabidopsis thaliana BAC T5E21 from chromosome I,
             complete sequence
          Length = 83351

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 176   atccgcatgcacttccatgactgctttgt 204
             ||||||||||||||||||||||| |||||
Sbjct: 16680 atccgcatgcacttccatgactgttttgt 16708



>gb|AC012188.2|F14L17 Sequence of BAC F14L17 from Arabidopsis thaliana chromosome 1, complete
              sequence
          Length = 111686

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 176    atccgcatgcacttccatgactgctttgt 204
              ||||||||||||||||||||||| |||||
Sbjct: 110287 atccgcatgcacttccatgactgttttgt 110315



>ref|NM_101322.1| Arabidopsis thaliana peroxidase AT1G14550 mRNA, complete cds
          Length = 966

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 176 atccgcatgcacttccatgactgctttgt 204
           ||||||||||||||||||||||| |||||
Sbjct: 181 atccgcatgcacttccatgactgttttgt 209



>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
          Length = 30432563

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 176     atccgcatgcacttccatgactgctttgt 204
               ||||||||||||||||||||||| |||||
Sbjct: 4979203 atccgcatgcacttccatgactgttttgt 4979231



>emb|BX657692.1| Arabidopsis thaliana T-DNA flanking sequence GK-625G12-022316,
            genomic survey sequence
          Length = 372

 Score = 44.1 bits (22), Expect = 0.061
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1245 gaaaacaaaactgatatttgtg 1266
            ||||||||||||||||||||||
Sbjct: 85   gaaaacaaaactgatatttgtg 64



>gb|BP603773.1|BP603773 BP603773 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-60-A09 3',
            mRNA sequence
          Length = 288

 Score = 44.1 bits (22), Expect = 0.061
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1242 attgaaaacaaaactgatattt 1263
            ||||||||||||||||||||||
Sbjct: 280  attgaaaacaaaactgatattt 259



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 440,874
Number of Sequences: 1013581
Number of extensions: 440874
Number of successful extensions: 31744
Number of sequences better than  0.5: 7
Number of HSP's better than  0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31395
Number of HSP's gapped (non-prelim): 349
length of query: 1326
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1306
effective length of database: 888,669,252
effective search space: 1160602043112
effective search space used: 1160602043112
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)