BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 4679577.2.1
(833 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AQ251312.1|AQ251312 T31K19-Sp6 TAMU Arabidopsis thaliana... 44 0.038
gb|AI993906.1|AI993906 701493320 A. thaliana, Ohio State cl... 44 0.038
emb|AX412439.1| Sequence 203 from Patent WO0222675 44 0.038
emb|AX412440.1| Sequence 204 from Patent WO0222675 44 0.038
emb|AX505533.1| Sequence 228 from Patent WO0216655 44 0.038
emb|AX589961.1| Sequence 143 from Patent WO02081695 44 0.038
emb|AX651362.1| Sequence 153 from Patent WO03000898 44 0.038
gb|BT010422.1| Arabidopsis thaliana At3g54420 mRNA, complet... 44 0.038
dbj|AK176488.1| Arabidopsis thaliana mRNA for class IV chit... 44 0.038
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 44 0.038
emb|AL132971.2|ATT12E18 Arabidopsis thaliana DNA chromosome... 44 0.038
emb|AL138656.2|ATT14E10 Arabidopsis thaliana DNA chromosome... 44 0.038
emb|Y14590.1|ATCHIV Arabidopsis thaliana CHIV gene 44 0.038
ref|NM_115302.2| Arabidopsis thaliana ATEP3; chitinase AT3G... 44 0.038
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 44 0.038
>gb|AQ251312.1|AQ251312 T31K19-Sp6 TAMU Arabidopsis thaliana genomic clone T31K19, DNA
sequence
Length = 753
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 365 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 316
>gb|AI993906.1|AI993906 701493320 A. thaliana, Ohio State clone set Arabidopsis thaliana
cDNA clone 701493320, mRNA sequence
Length = 477
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 349 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 300
>emb|AX412439.1| Sequence 203 from Patent WO0222675
Length = 822
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 505 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 554
>emb|AX412440.1| Sequence 204 from Patent WO0222675
Length = 822
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 505 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 554
>emb|AX505533.1| Sequence 228 from Patent WO0216655
Length = 822
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 505 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 554
>emb|AX589961.1| Sequence 143 from Patent WO02081695
Length = 822
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 505 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 554
>emb|AX651362.1| Sequence 153 from Patent WO03000898
Length = 822
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 505 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 554
>gb|BT010422.1| Arabidopsis thaliana At3g54420 mRNA, complete cds
Length = 822
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 505 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 554
>dbj|AK176488.1| Arabidopsis thaliana mRNA for class IV chitinase (CHIV), complete
cds, clone: RAFL24-30-I06
Length = 2082
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 548 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 597
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 20110168 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 20110217
>emb|AL132971.2|ATT12E18 Arabidopsis thaliana DNA chromosome 3, BAC clone T12E18
Length = 40844
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 34893 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 34942
>emb|AL138656.2|ATT14E10 Arabidopsis thaliana DNA chromosome 3, BAC clone T14E10
Length = 94911
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 15445 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 15494
>emb|Y14590.1|ATCHIV Arabidopsis thaliana CHIV gene
Length = 2381
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 1867 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 1916
>ref|NM_115302.2| Arabidopsis thaliana ATEP3; chitinase AT3G54420 (ATEP3) mRNA,
complete cds
Length = 876
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 530 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 579
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 44.1 bits (22), Expect = 0.038
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 353 tactacggccgcggcccgctgcagatctcctggaacttcaactacgggcc 402
|||||||||||||| ||| | || |||| ||||| ||||||||||||||
Sbjct: 20157695 tactacggccgcggaccgatccaactctcttggaatttcaactacgggcc 20157744
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 222,430
Number of Sequences: 1013581
Number of extensions: 222430
Number of successful extensions: 14506
Number of sequences better than 0.5: 15
Number of HSP's better than 0.5 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14394
Number of HSP's gapped (non-prelim): 112
length of query: 833
length of database: 908,940,872
effective HSP length: 20
effective length of query: 813
effective length of database: 888,669,252
effective search space: 722488101876
effective search space used: 722488101876
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)