BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3829259.2.1
(1019 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BT011226.1| Arabidopsis thaliana 109 1e-021
emb|BX817161.1|CNS0ABLN Arabidopsis thaliana Full-length cD... 109 1e-021
emb|BX813435.1|CNS0AC0X Arabidopsis thaliana Full-length cD... 109 1e-021
emb|BX815944.1|CNS0ABVK Arabidopsis thaliana Full-length cD... 109 1e-021
emb|BX816595.1|CNS0ABW1 Arabidopsis thaliana Full-length cD... 109 1e-021
gb|BT012154.1| Arabidopsis thaliana At1g64440 mRNA, complet... 109 1e-021
ref|NM_105119.3| Arabidopsis thaliana RHD1 (ROOT HAIR DEFEC... 109 1e-021
emb|BX818643.1|CNS0AAWT Arabidopsis thaliana Full-length cD... 107 4e-021
gb|AC009519.4|AC009519 Genomic sequence for Arabidopsis tha... 96 1e-017
gb|AC066689.5|AC066689 Arabidopsis thaliana chromosome 1 BA... 96 1e-017
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 96 1e-017
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 96 1e-017
gb|CC795429.1|CC795429 SALK_080766.36.40.x Arabidopsis thal... 66 1e-008
gb|AV544957.1|AV544957 AV544957 Arabidopsis thaliana roots ... 52 2e-004
gb|AF080118.1|F8M12 Arabidopsis thaliana BAC F8M12 48 0.003
gb|AY140073.1| Arabidopsis thaliana UDP-galactose 4-epimera... 48 0.003
gb|AY065354.1| Arabidopsis thaliana putative UDP-galactose ... 48 0.003
gb|AY117180.1| Arabidopsis thaliana putative UDP-galactose ... 48 0.003
emb|BX827643.1|CNS0A2DZ Arabidopsis thaliana Full-length cD... 48 0.003
emb|BX827147.1|CNS0A3P3 Arabidopsis thaliana Full-length cD... 48 0.003
emb|BX827895.1|CNS0A3UR Arabidopsis thaliana Full-length cD... 48 0.003
emb|BX826665.1|CNS0A44W Arabidopsis thaliana Full-length cD... 48 0.003
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 48 0.003
emb|AL049525.1|ATF25I24 Arabidopsis thaliana DNA chromosome... 48 0.003
emb|AL161518.2|ATCHRIV30 Arabidopsis thaliana DNA chromosom... 48 0.003
ref|NM_117165.2| Arabidopsis thaliana triacylglycerol lipas... 48 0.003
ref|NM_117166.2| Arabidopsis thaliana NAD binding / UDP-glu... 48 0.003
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 48 0.003
emb|AJ551585.1|ATH551585 Arabidopsis thaliana T-DNA flankin... 44 0.047
gb|AY085528.1| Arabidopsis thaliana clone 15608 mRNA, compl... 44 0.047
gb|AV819967.1|AV819967 AV819967 RAFL11 Arabidopsis thaliana... 42 0.19
gb|BX834875.1|BX834875 BX834875 Arabidopsis thaliana Hormon... 42 0.19
gb|AV541983.1|AV541983 AV541983 Arabidopsis thaliana roots ... 42 0.19
gb|BT008539.1| Arabidopsis thaliana clone U51171 putative U... 42 0.19
gb|AC007127.7| Arabidopsis thaliana chromosome 2 clone T23A... 42 0.19
dbj|AK118722.1| Arabidopsis thaliana At4g23920 mRNA for put... 42 0.19
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 42 0.19
emb|AL162295.1|ATT4C21 Arabidopsis thaliana DNA chromosome ... 42 0.19
emb|AL358732.1|ATT27I15 Arabidopsis thaliana DNA chromosome... 42 0.19
ref|NM_118524.2| Arabidopsis thaliana NAD binding / UDP-glu... 42 0.19
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 42 0.19
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 42 0.19
>gb|BT011226.1| Arabidopsis thaliana
Length = 1368
Score = 109 bits (55), Expect = 1e-021
Identities = 85/95 (89%)
Strand = Plus / Minus
Query: 623 gggattttctttccagaagccttctcaaatgcattgactatctccaacactgatgttcct 682
||||||||| |||||||||| ||||||||||||| || ||||||||||||| |||||||
Sbjct: 908 gggattttcattccagaagctttctcaaatgcatcaaccatctccaacactgttgttcct 849
Query: 683 tttccggttccaaggttgtatgcttcacatcctat 717
||||||||||| ||||||||| | ||||| |||||
Sbjct: 848 tttccggttcccaggttgtatacctcacaacctat 814
>emb|BX817161.1|CNS0ABLN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH8ZE10 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1388
Score = 109 bits (55), Expect = 1e-021
Identities = 85/95 (89%)
Strand = Plus / Minus
Query: 623 gggattttctttccagaagccttctcaaatgcattgactatctccaacactgatgttcct 682
||||||||| |||||||||| ||||||||||||| || ||||||||||||| |||||||
Sbjct: 916 gggattttcattccagaagctttctcaaatgcatcaaccatctccaacactgttgttcct 857
Query: 683 tttccggttccaaggttgtatgcttcacatcctat 717
||||||||||| ||||||||| | ||||| |||||
Sbjct: 856 tttccggttcccaggttgtatacctcacaacctat 822
>emb|BX813435.1|CNS0AC0X Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB17ZE12 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1315
Score = 109 bits (55), Expect = 1e-021
Identities = 85/95 (89%)
Strand = Plus / Minus
Query: 623 gggattttctttccagaagccttctcaaatgcattgactatctccaacactgatgttcct 682
||||||||| |||||||||| ||||||||||||| || ||||||||||||| |||||||
Sbjct: 892 gggattttcattccagaagctttctcaaatgcatcaaccatctccaacactgttgttcct 833
Query: 683 tttccggttccaaggttgtatgcttcacatcctat 717
||||||||||| ||||||||| | ||||| |||||
Sbjct: 832 tttccggttcccaggttgtatacctcacaacctat 798
>emb|BX815944.1|CNS0ABVK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH19ZC12 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1353
Score = 109 bits (55), Expect = 1e-021
Identities = 85/95 (89%)
Strand = Plus / Minus
Query: 623 gggattttctttccagaagccttctcaaatgcattgactatctccaacactgatgttcct 682
||||||||| |||||||||| ||||||||||||| || ||||||||||||| |||||||
Sbjct: 927 gggattttcattccagaagctttctcaaatgcatcaaccatctccaacactgttgttcct 868
Query: 683 tttccggttccaaggttgtatgcttcacatcctat 717
||||||||||| ||||||||| | ||||| |||||
Sbjct: 867 tttccggttcccaggttgtatacctcacaacctat 833
>emb|BX816595.1|CNS0ABW1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH58ZA04 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1362
Score = 109 bits (55), Expect = 1e-021
Identities = 85/95 (89%)
Strand = Plus / Minus
Query: 623 gggattttctttccagaagccttctcaaatgcattgactatctccaacactgatgttcct 682
||||||||| |||||||||| ||||||||||||| || ||||||||||||| |||||||
Sbjct: 928 gggattttcattccagaagctttctcaaatgcatcaaccatctccaacactgttgttcct 869
Query: 683 tttccggttccaaggttgtatgcttcacatcctat 717
||||||||||| ||||||||| | ||||| |||||
Sbjct: 868 tttccggttcccaggttgtatacctcacaacctat 834
>gb|BT012154.1| Arabidopsis thaliana At1g64440 mRNA, complete cds
Length = 1047
Score = 109 bits (55), Expect = 1e-021
Identities = 85/95 (89%)
Strand = Plus / Minus
Query: 623 gggattttctttccagaagccttctcaaatgcattgactatctccaacactgatgttcct 682
||||||||| |||||||||| ||||||||||||| || ||||||||||||| |||||||
Sbjct: 869 gggattttcattccagaagctttctcaaatgcatcaaccatctccaacactgttgttcct 810
Query: 683 tttccggttccaaggttgtatgcttcacatcctat 717
||||||||||| ||||||||| | ||||| |||||
Sbjct: 809 tttccggttcccaggttgtatacctcacaacctat 775
>ref|NM_105119.3| Arabidopsis thaliana RHD1 (ROOT HAIR DEFECTIVE 1) AT1G64440 (RHD1)
mRNA, complete cds
Length = 1440
Score = 109 bits (55), Expect = 1e-021
Identities = 85/95 (89%)
Strand = Plus / Minus
Query: 623 gggattttctttccagaagccttctcaaatgcattgactatctccaacactgatgttcct 682
||||||||| |||||||||| ||||||||||||| || ||||||||||||| |||||||
Sbjct: 928 gggattttcattccagaagctttctcaaatgcatcaaccatctccaacactgttgttcct 869
Query: 683 tttccggttccaaggttgtatgcttcacatcctat 717
||||||||||| ||||||||| | ||||| |||||
Sbjct: 868 tttccggttcccaggttgtatacctcacaacctat 834
>emb|BX818643.1|CNS0AAWT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL8ZE11 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 1254
Score = 107 bits (54), Expect = 4e-021
Identities = 84/94 (89%)
Strand = Plus / Minus
Query: 624 ggattttctttccagaagccttctcaaatgcattgactatctccaacactgatgttcctt 683
|||||||| |||||||||| ||||||||||||| || ||||||||||||| ||||||||
Sbjct: 921 ggattttcattccagaagctttctcaaatgcatcaaccatctccaacactgttgttcctt 862
Query: 684 ttccggttccaaggttgtatgcttcacatcctat 717
|||||||||| ||||||||| | ||||| |||||
Sbjct: 861 ttccggttcccaggttgtatacctcacaacctat 828
>gb|AC009519.4|AC009519 Genomic sequence for Arabidopsis thaliana BAC F1N19 from chromosome
I, complete sequence
Length = 113172
Score = 95.6 bits (48), Expect = 1e-017
Identities = 75/84 (89%)
Strand = Plus / Minus
Query: 633 ttccagaagccttctcaaatgcattgactatctccaacactgatgttccttttccggttc 692
|||||||||| ||||||||||||| || ||||||||||||| |||||||||||||||||
Sbjct: 7436 ttccagaagctttctcaaatgcatcaaccatctccaacactgttgttccttttccggttc 7377
Query: 693 caaggttgtatgcttcacatccta 716
| ||||||||| | ||||| ||||
Sbjct: 7376 ccaggttgtatacctcacaaccta 7353
>gb|AC066689.5|AC066689 Arabidopsis thaliana chromosome 1 BAC F15H21 genomic sequence,
complete sequence
Length = 96887
Score = 95.6 bits (48), Expect = 1e-017
Identities = 75/84 (89%)
Strand = Plus / Plus
Query: 633 ttccagaagccttctcaaatgcattgactatctccaacactgatgttccttttccggttc 692
|||||||||| ||||||||||||| || ||||||||||||| |||||||||||||||||
Sbjct: 4526 ttccagaagctttctcaaatgcatcaaccatctccaacactgttgttccttttccggttc 4585
Query: 693 caaggttgtatgcttcacatccta 716
| ||||||||| | ||||| ||||
Sbjct: 4586 ccaggttgtatacctcacaaccta 4609
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 95.6 bits (48), Expect = 1e-017
Identities = 75/84 (89%)
Strand = Plus / Minus
Query: 633 ttccagaagccttctcaaatgcattgactatctccaacactgatgttccttttccggttc 692
|||||||||| ||||||||||||| || ||||||||||||| |||||||||||||||||
Sbjct: 8180463 ttccagaagctttctcaaatgcatcaaccatctccaacactgttgttccttttccggttc 8180404
Query: 693 caaggttgtatgcttcacatccta 716
| ||||||||| | ||||| ||||
Sbjct: 8180403 ccaggttgtatacctcacaaccta 8180380
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 95.6 bits (48), Expect = 1e-017
Identities = 75/84 (89%)
Strand = Plus / Minus
Query: 633 ttccagaagccttctcaaatgcattgactatctccaacactgatgttccttttccggttc 692
|||||||||| ||||||||||||| || ||||||||||||| |||||||||||||||||
Sbjct: 23942811 ttccagaagctttctcaaatgcatcaaccatctccaacactgttgttccttttccggttc 23942752
Query: 693 caaggttgtatgcttcacatccta 716
| ||||||||| | ||||| ||||
Sbjct: 23942751 ccaggttgtatacctcacaaccta 23942728
>gb|CC795429.1|CC795429 SALK_080766.36.40.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_080766.36.40.x,
DNA sequence
Length = 396
Score = 65.9 bits (33), Expect = 1e-008
Identities = 51/57 (89%)
Strand = Plus / Minus
Query: 633 ttccagaagccttctcaaatgcattgactatctccaacactgatgttccttttccgg 689
|||||||||| ||||||||||||| || ||||||||||||| ||| ||||||||||
Sbjct: 69 ttccagaagctttctcaaatgcatcaaccatctccaacactggtgtgccttttccgg 13
>gb|AV544957.1|AV544957 AV544957 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ65e03F 3', mRNA sequence
Length = 481
Score = 52.0 bits (26), Expect = 2e-004
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 623 gggattttctttccagaagccttctcaaatgcat 656
||||||||| |||||||||| |||||||||||||
Sbjct: 447 gggattttcattccagaagctttctcaaatgcat 480
>gb|AF080118.1|F8M12 Arabidopsis thaliana BAC F8M12
Length = 103673
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Minus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 30488 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 30429
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 30428 gcaccaacaggattgaaatacctaagcaatataatcttccattc 30385
>gb|AY140073.1| Arabidopsis thaliana UDP-galactose 4-epimerase-like protein
(At4g10960) mRNA, complete cds
Length = 2800
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Minus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 705 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 646
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 645 gcaccaacaggattgaaatacctaagcaatataatcttccattc 602
>gb|AY065354.1| Arabidopsis thaliana putative UDP-galactose 4-epimerase (At4g10960)
mRNA, complete cds
Length = 1356
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Minus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 705 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 646
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 645 gcaccaacaggattgaaatacctaagcaatataatcttccattc 602
>gb|AY117180.1| Arabidopsis thaliana putative UDP-galactose 4-epimerase (At4g10960)
mRNA, complete cds
Length = 1087
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Minus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 623 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 564
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 563 gcaccaacaggattgaaatacctaagcaatataatcttccattc 520
>emb|BX827643.1|CNS0A2DZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS8ZA03 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1272
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Minus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 671 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 612
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 611 gcaccaacaggattgaaatacctaagcaatataatcttccattc 568
>emb|BX827147.1|CNS0A3P3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS16ZC07 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1253
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Minus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 688 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 629
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 628 gcaccaacaggattgaaatacctaagcaatataatcttccattc 585
>emb|BX827895.1|CNS0A3UR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH32ZD08 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1339
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Minus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 746 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 687
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 686 gcaccaacaggattgaaatacctaagcaatataatcttccattc 643
>emb|BX826665.1|CNS0A44W Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB52ZC08 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1305
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Minus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 685 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 626
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 625 gcaccaacaggattgaaatacctaagcaatataatcttccattc 582
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Plus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 2629619 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 2629678
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 2629679 gcaccaacaggattgaaatacctaagcaatataatcttccattc 2629722
>emb|AL049525.1|ATF25I24 Arabidopsis thaliana DNA chromosome 4, BAC clone F25I24 (ESSA project)
Length = 95799
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Plus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 73236 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 73295
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 73296 gcaccaacaggattgaaatacctaagcaatataatcttccattc 73339
>emb|AL161518.2|ATCHRIV30 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 30
Length = 198136
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Plus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 154260 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 154319
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 154320 gcaccaacaggattgaaatacctaagcaatataatcttccattc 154363
>ref|NM_117165.2| Arabidopsis thaliana triacylglycerol lipase AT4G10955 mRNA,
complete cds
Length = 2749
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Minus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 706 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 647
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 646 gcaccaacaggattgaaatacctaagcaatataatcttccattc 603
>ref|NM_117166.2| Arabidopsis thaliana NAD binding / UDP-glucose 4-epimerase/
catalytic AT4G10960 mRNA, complete cds
Length = 2827
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Minus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 701 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 642
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 641 gcaccaacaggattgaaatacctaagcaatataatcttccattc 598
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 48.1 bits (24), Expect = 0.003
Identities = 84/104 (80%)
Strand = Plus / Plus
Query: 879 aagggcataaggttgttaggagttccacatgggtcttcaccaaggtatccactggggtga 938
|||||||| || ||||| ||| | |||| ||||||||||||| || ||||| || ||
Sbjct: 6716884 aagggcatgagattgtttggaataccacgagggtcttcaccaatgtcaccactaggatgt 6716943
Query: 939 gccccaactggattaaagtacctaagcaaaatgatattccattc 982
|| ||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 6716944 gcaccaacaggattgaaatacctaagcaatataatcttccattc 6716987
>emb|AJ551585.1|ATH551585 Arabidopsis thaliana T-DNA flanking sequence, left border, clone
276F07
Length = 395
Score = 44.1 bits (22), Expect = 0.047
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 552 ctctctctgcttttgccggcga 573
||||||||||||||||||||||
Sbjct: 232 ctctctctgcttttgccggcga 253
>gb|AY085528.1| Arabidopsis thaliana clone 15608 mRNA, complete sequence
Length = 1286
Score = 44.1 bits (22), Expect = 0.047
Identities = 61/74 (82%)
Strand = Plus / Minus
Query: 909 gggtcttcaccaaggtatccactggggtgagccccaactggattaaagtacctaagcaaa 968
||||||||||||| || ||||| || || || ||||| ||||| || |||||||||||
Sbjct: 671 gggtcttcaccaatgtcaccactaggatgtgcaccaacaggattgaaatacctaagcaat 612
Query: 969 atgatattccattc 982
|| || ||||||||
Sbjct: 611 ataatcttccattc 598
>gb|AV819967.1|AV819967 AV819967 RAFL11 Arabidopsis thaliana cDNA clone RAFL11-08-D06 3',
mRNA sequence
Length = 416
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 612 ccatgaccaaagggattttctttcc 636
|||| ||||||||||||||||||||
Sbjct: 334 ccatcaccaaagggattttctttcc 358
>gb|BX834875.1|BX834875 BX834875 Arabidopsis thaliana Hormone Treated Callus Col-0
Arabidopsis thaliana cDNA clone GSLTPGH55ZB10 3PRIM,
mRNA sequence
Length = 913
Score = 42.1 bits (21), Expect = 0.19
Identities = 66/81 (81%)
Strand = Plus / Plus
Query: 623 gggattttctttccagaagccttctcaaatgcattgactatctccaacactgatgttcct 682
|||||||| |||||||||| ||| ||||||| | || ||| | |||| | ||||||
Sbjct: 391 gggattttgattccagaagcgttcgcaaatgcgtcaaccatcggcgacacggttgttccg 450
Query: 683 tttccggttccaaggttgtat 703
||||||||||| |||||||||
Sbjct: 451 tttccggttccgaggttgtat 471
>gb|AV541983.1|AV541983 AV541983 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ175a04F 3', mRNA sequence
Length = 581
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 612 ccatgaccaaagggattttctttcc 636
|||| ||||||||||||||||||||
Sbjct: 349 ccatcaccaaagggattttctttcc 373
>gb|BT008539.1| Arabidopsis thaliana clone U51171 putative UDPglucose 4-epimerase
(At4g23920) mRNA, complete cds
Length = 1084
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 612 ccatgaccaaagggattttctttcc 636
|||| ||||||||||||||||||||
Sbjct: 880 ccatcaccaaagggattttctttcc 856
>gb|AC007127.7| Arabidopsis thaliana chromosome 2 clone T23A1 map mi398, complete
sequence
Length = 35515
Score = 42.1 bits (21), Expect = 0.19
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 553 tctctctgcttttgccggcga 573
|||||||||||||||||||||
Sbjct: 5486 tctctctgcttttgccggcga 5506
>dbj|AK118722.1| Arabidopsis thaliana At4g23920 mRNA for putative UDPglucose
4-epimerase, complete cds, clone: RAFL21-04-N18
Length = 1393
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 612 ccatgaccaaagggattttctttcc 636
|||| ||||||||||||||||||||
Sbjct: 1030 ccatcaccaaagggattttctttcc 1006
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 100 aatacaattacaaaagaaaatttgt 124
||||||||| |||||||||||||||
Sbjct: 22461220 aatacaatttcaaaagaaaatttgt 22461196
>emb|AL162295.1|ATT4C21 Arabidopsis thaliana DNA chromosome 3, BAC clone T4C21
Length = 107865
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 100 aatacaattacaaaagaaaatttgt 124
||||||||| |||||||||||||||
Sbjct: 104204 aatacaatttcaaaagaaaatttgt 104180
>emb|AL358732.1|ATT27I15 Arabidopsis thaliana DNA chromosome 3, BAC clone T27I15
Length = 112584
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 100 aatacaattacaaaagaaaatttgt 124
||||||||| |||||||||||||||
Sbjct: 742 aatacaatttcaaaagaaaatttgt 718
>ref|NM_118524.2| Arabidopsis thaliana NAD binding / UDP-glucose 4-epimerase/ catalytic
AT4G23920 mRNA, complete cds
Length = 1390
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 612 ccatgaccaaagggattttctttcc 636
|||| ||||||||||||||||||||
Sbjct: 1019 ccatcaccaaagggattttctttcc 995
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 42.1 bits (21), Expect = 0.19
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 553 tctctctgcttttgccggcga 573
|||||||||||||||||||||
Sbjct: 7481787 tctctctgcttttgccggcga 7481807
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 42.1 bits (21), Expect = 0.19
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 100 aatacaattacaaaagaaaatttgt 124
||||||||| |||||||||||||||
Sbjct: 22513921 aatacaatttcaaaagaaaatttgt 22513897
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 582,502
Number of Sequences: 1013581
Number of extensions: 582502
Number of successful extensions: 45979
Number of sequences better than 0.5: 42
Number of HSP's better than 0.5 without gapping: 41
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 43987
Number of HSP's gapped (non-prelim): 1984
length of query: 1019
length of database: 908,940,872
effective HSP length: 20
effective length of query: 999
effective length of database: 888,669,252
effective search space: 887780582748
effective search space used: 887780582748
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)