BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3802552.2.1
         (252 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CL496025.1|CL496025  SAIL_619_C03.v1 SAIL Collection Arab...    40   0.17 

>gb|CL496025.1|CL496025 SAIL_619_C03.v1 SAIL Collection Arabidopsis thaliana genomic clone
           SAIL_619_C03.v1, DNA sequence
          Length = 2209

 Score = 40.1 bits (20), Expect = 0.17
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 180 cggcgacggcgcggcggccg 199
           ||||||||||||||||||||
Sbjct: 738 cggcgacggcgcggcggccg 757



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 41,950
Number of Sequences: 1013581
Number of extensions: 41950
Number of successful extensions: 11162
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11161
Number of HSP's gapped (non-prelim): 1
length of query: 252
length of database: 908,940,872
effective HSP length: 19
effective length of query: 233
effective length of database: 889,682,833
effective search space: 207296100089
effective search space used: 207296100089
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)