BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3570920.2.1
(786 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|B76773.1|B76773 T26F3TR TAMU Arabidopsis thaliana genomi... 62 2e-007
emb|AL096692.1|F17A13 Arabidopsis thaliana clone F17A13, **... 62 2e-007
gb|AY072133.1| Arabidopsis thaliana putative beta-1,3-gluca... 62 2e-007
gb|AY096465.1| Arabidopsis thaliana putative beta-1,3-gluca... 62 2e-007
gb|AY088354.1| Arabidopsis thaliana clone 6076 mRNA, comple... 62 2e-007
emb|BX826928.1|CNS0A4A2 Arabidopsis thaliana Full-length cD... 62 2e-007
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 62 2e-007
emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosom... 62 2e-007
ref|NM_119081.3| Arabidopsis thaliana hydrolase, hydrolyzin... 62 2e-007
ref|NM_179225.2| Arabidopsis thaliana hydrolase, hydrolyzin... 62 2e-007
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 62 2e-007
gb|CB074404.1|CB074404 EST00928 Virulent Peronospora parasi... 46 0.009
emb|BX662824.1| Arabidopsis thaliana T-DNA flanking sequenc... 44 0.036
gb|CB239324.1|CB239324 EST01145 Arabidopsis virulent Pseudo... 44 0.036
gb|CB097368.1|CB097368 EST00995 Virulent Peronospora parasi... 44 0.036
gb|AY133637.1| Arabidopsis thaliana AT5g56590/MIK19_3 mRNA,... 44 0.036
emb|AX507774.1| Sequence 2469 from Patent WO0216655 44 0.036
gb|CB185880.1|CB185880 EST01071 Arabidopsis virulent Pseudo... 42 0.14
gb|CB074223.1|CB074223 EST01000 Virulent Peronospora parasi... 42 0.14
gb|CB074411.1|CB074411 EST00927 Virulent Peronospora parasi... 42 0.14
gb|AY075591.1| Arabidopsis thaliana AT5g56590/MIK19_3 mRNA,... 42 0.14
emb|BX830494.1|CNS09ZWJ Arabidopsis thaliana Full-length cD... 42 0.14
dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosom... 42 0.14
ref|NM_125042.2| Arabidopsis thaliana hydrolase, hydrolyzin... 42 0.14
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 42 0.14
>gb|B76773.1|B76773 T26F3TR TAMU Arabidopsis thaliana genomic clone T26F3, DNA sequence
Length = 415
Score = 61.9 bits (31), Expect = 2e-007
Identities = 70/83 (84%)
Strand = Plus / Minus
Query: 592 gaagagattgatgtctacatattttcattgttcaatgagaacaggaaacctggcatcgag 651
|||||||| ||||| ||| |||| || ||||||||||||||| |||| ||||| || ||
Sbjct: 273 gaagagatagatgtgtacttattctcgttgttcaatgagaaccggaagcctgggatagaa 214
Query: 652 tcggagaggaactggggactgtt 674
|| ||||| ||||||||| ||||
Sbjct: 213 tccgagagaaactggggaatgtt 191
>emb|AL096692.1|F17A13 Arabidopsis thaliana clone F17A13, *** SEQUENCING IN PROGRESS ***
Length = 100310
Score = 61.9 bits (31), Expect = 2e-007
Identities = 70/83 (84%)
Strand = Plus / Minus
Query: 592 gaagagattgatgtctacatattttcattgttcaatgagaacaggaaacctggcatcgag 651
|||||||| ||||| ||| |||| || ||||||||||||||| |||| ||||| || ||
Sbjct: 62473 gaagagatagatgtgtacttattctcgttgttcaatgagaaccggaagcctgggatagaa 62414
Query: 652 tcggagaggaactggggactgtt 674
|| ||||| ||||||||| ||||
Sbjct: 62413 tccgagagaaactggggaatgtt 62391
>gb|AY072133.1| Arabidopsis thaliana putative beta-1,3-glucanase (At4g29360) mRNA,
complete cds
Length = 1936
Score = 61.9 bits (31), Expect = 2e-007
Identities = 70/83 (84%)
Strand = Plus / Plus
Query: 592 gaagagattgatgtctacatattttcattgttcaatgagaacaggaaacctggcatcgag 651
|||||||| ||||| ||| |||| || ||||||||||||||| |||| ||||| || ||
Sbjct: 1092 gaagagatagatgtgtacttattctcgttgttcaatgagaaccggaagcctgggatagaa 1151
Query: 652 tcggagaggaactggggactgtt 674
|| ||||| ||||||||| ||||
Sbjct: 1152 tccgagagaaactggggaatgtt 1174
>gb|AY096465.1| Arabidopsis thaliana putative beta-1,3-glucanase (At4g29360) mRNA,
complete cds
Length = 1636
Score = 61.9 bits (31), Expect = 2e-007
Identities = 70/83 (84%)
Strand = Plus / Plus
Query: 592 gaagagattgatgtctacatattttcattgttcaatgagaacaggaaacctggcatcgag 651
|||||||| ||||| ||| |||| || ||||||||||||||| |||| ||||| || ||
Sbjct: 916 gaagagatagatgtgtacttattctcgttgttcaatgagaaccggaagcctgggatagaa 975
Query: 652 tcggagaggaactggggactgtt 674
|| ||||| ||||||||| ||||
Sbjct: 976 tccgagagaaactggggaatgtt 998
>gb|AY088354.1| Arabidopsis thaliana clone 6076 mRNA, complete sequence
Length = 1886
Score = 61.9 bits (31), Expect = 2e-007
Identities = 70/83 (84%)
Strand = Plus / Plus
Query: 592 gaagagattgatgtctacatattttcattgttcaatgagaacaggaaacctggcatcgag 651
|||||||| ||||| ||| |||| || ||||||||||||||| |||| ||||| || ||
Sbjct: 956 gaagagatagatgtgtacttattctcgttgttcaatgagaaccggaagcctgggatagaa 1015
Query: 652 tcggagaggaactggggactgtt 674
|| ||||| ||||||||| ||||
Sbjct: 1016 tccgagagaaactggggaatgtt 1038
>emb|BX826928.1|CNS0A4A2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB77ZD02 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1790
Score = 61.9 bits (31), Expect = 2e-007
Identities = 70/83 (84%)
Strand = Plus / Plus
Query: 592 gaagagattgatgtctacatattttcattgttcaatgagaacaggaaacctggcatcgag 651
|||||||| ||||| ||| |||| || ||||||||||||||| |||| ||||| || ||
Sbjct: 1067 gaagagatagatgtgtacttattctcgttgttcaatgagaaccggaagcctgggatagaa 1126
Query: 652 tcggagaggaactggggactgtt 674
|| ||||| ||||||||| ||||
Sbjct: 1127 tccgagagaaactggggaatgtt 1149
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 61.9 bits (31), Expect = 2e-007
Identities = 70/83 (84%)
Strand = Plus / Minus
Query: 592 gaagagattgatgtctacatattttcattgttcaatgagaacaggaaacctggcatcgag 651
|||||||| ||||| ||| |||| || ||||||||||||||| |||| ||||| || ||
Sbjct: 10365208 gaagagatagatgtgtacttattctcgttgttcaatgagaaccggaagcctgggatagaa 10365149
Query: 652 tcggagaggaactggggactgtt 674
|| ||||| ||||||||| ||||
Sbjct: 10365148 tccgagagaaactggggaatgtt 10365126
>emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 70
Length = 198429
Score = 61.9 bits (31), Expect = 2e-007
Identities = 70/83 (84%)
Strand = Plus / Minus
Query: 592 gaagagattgatgtctacatattttcattgttcaatgagaacaggaaacctggcatcgag 651
|||||||| ||||| ||| |||| || ||||||||||||||| |||| ||||| || ||
Sbjct: 180512 gaagagatagatgtgtacttattctcgttgttcaatgagaaccggaagcctgggatagaa 180453
Query: 652 tcggagaggaactggggactgtt 674
|| ||||| ||||||||| ||||
Sbjct: 180452 tccgagagaaactggggaatgtt 180430
>ref|NM_119081.3| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT4G29360 transcript variant AT4G29360.2 mRNA, complete
cds
Length = 1885
Score = 61.9 bits (31), Expect = 2e-007
Identities = 70/83 (84%)
Strand = Plus / Plus
Query: 592 gaagagattgatgtctacatattttcattgttcaatgagaacaggaaacctggcatcgag 651
|||||||| ||||| ||| |||| || ||||||||||||||| |||| ||||| || ||
Sbjct: 956 gaagagatagatgtgtacttattctcgttgttcaatgagaaccggaagcctgggatagaa 1015
Query: 652 tcggagaggaactggggactgtt 674
|| ||||| ||||||||| ||||
Sbjct: 1016 tccgagagaaactggggaatgtt 1038
>ref|NM_179225.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT4G29360 transcript variant AT4G29360.1 mRNA, complete
cds
Length = 1922
Score = 61.9 bits (31), Expect = 2e-007
Identities = 70/83 (84%)
Strand = Plus / Plus
Query: 592 gaagagattgatgtctacatattttcattgttcaatgagaacaggaaacctggcatcgag 651
|||||||| ||||| ||| |||| || ||||||||||||||| |||| ||||| || ||
Sbjct: 1092 gaagagatagatgtgtacttattctcgttgttcaatgagaaccggaagcctgggatagaa 1151
Query: 652 tcggagaggaactggggactgtt 674
|| ||||| ||||||||| ||||
Sbjct: 1152 tccgagagaaactggggaatgtt 1174
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 61.9 bits (31), Expect = 2e-007
Identities = 70/83 (84%)
Strand = Plus / Minus
Query: 592 gaagagattgatgtctacatattttcattgttcaatgagaacaggaaacctggcatcgag 651
|||||||| ||||| ||| |||| || ||||||||||||||| |||| ||||| || ||
Sbjct: 14452438 gaagagatagatgtgtacttattctcgttgttcaatgagaaccggaagcctgggatagaa 14452379
Query: 652 tcggagaggaactggggactgtt 674
|| ||||| ||||||||| ||||
Sbjct: 14452378 tccgagagaaactggggaatgtt 14452356
>gb|CB074404.1|CB074404 EST00928 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-FF12 similar to UNKNOWN PROTEIN, mRNA sequence
Length = 617
Score = 46.1 bits (23), Expect = 0.009
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 763 aatggtacctgcccgggcggccg 785
|||||||||||||||||||||||
Sbjct: 590 aatggtacctgcccgggcggccg 612
>emb|BX662824.1| Arabidopsis thaliana T-DNA flanking sequence GK-708H07-022965,
genomic survey sequence
Length = 416
Score = 44.1 bits (22), Expect = 0.036
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 765 tggtacctgcccgggcggccgc 786
||||||||||||||||||||||
Sbjct: 54 tggtacctgcccgggcggccgc 33
>gb|CB239324.1|CB239324 EST01145 Arabidopsis virulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone DC1-C2 similar
to putative tyrosine aminotransferase, mRNA sequence
Length = 579
Score = 44.1 bits (22), Expect = 0.036
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 765 tggtacctgcccgggcggccgc 786
||||||||||||||||||||||
Sbjct: 61 tggtacctgcccgggcggccgc 40
>gb|CB097368.1|CB097368 EST00995 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-AA5 similar to NAD dependent epimerase, mRNA
sequence
Length = 601
Score = 44.1 bits (22), Expect = 0.036
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 765 tggtacctgcccgggcggccgc 786
||||||||||||||||||||||
Sbjct: 450 tggtacctgcccgggcggccgc 471
>gb|AY133637.1| Arabidopsis thaliana AT5g56590/MIK19_3 mRNA, complete cds
Length = 1521
Score = 44.1 bits (22), Expect = 0.036
Identities = 46/54 (85%)
Strand = Plus / Plus
Query: 167 ggtcgttcccgccgtctgctggggcgttcaacagcagctacgcctacttcttga 220
|||| ||||| || |||||||| || |||||||||||||| || || |||||||
Sbjct: 494 ggtctttccctccttctgctggagcattcaacagcagctatgcttatttcttga 547
>emb|AX507774.1| Sequence 2469 from Patent WO0216655
Length = 238
Score = 44.1 bits (22), Expect = 0.036
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 765 tggtacctgcccgggcggccgc 786
||||||||||||||||||||||
Sbjct: 26 tggtacctgcccgggcggccgc 5
>gb|CB185880.1|CB185880 EST01071 Arabidopsis virulent Pseudomonas syringae subtracted
library Arabidopsis thaliana cDNA clone DC4-H4 similar
to putative protein with homology to rubisco small
subunit, mRNA sequence
Length = 370
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 766 ggtacctgcccgggcggccgc 786
|||||||||||||||||||||
Sbjct: 85 ggtacctgcccgggcggccgc 65
>gb|CB074223.1|CB074223 EST01000 Virulent Peronospora parasitica Infected Arabidopsis
reverse-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-RAA10 similar to chlorophyll a/b-binding
protein, mRNA sequence
Length = 527
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 766 ggtacctgcccgggcggccgc 786
|||||||||||||||||||||
Sbjct: 365 ggtacctgcccgggcggccgc 385
>gb|CB074411.1|CB074411 EST00927 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-FF9 similar to UNKNOWN PROTEIN, mRNA sequence
Length = 421
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 766 ggtacctgcccgggcggccgc 786
|||||||||||||||||||||
Sbjct: 396 ggtacctgcccgggcggccgc 416
>gb|AY075591.1| Arabidopsis thaliana AT5g56590/MIK19_3 mRNA, complete cds
Length = 1773
Score = 42.1 bits (21), Expect = 0.14
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 172 ttcccgccgtctgctggggcgttcaacagcagctacgcctacttcttga 220
||||| || |||||||| || |||||||||||||| || || |||||||
Sbjct: 697 ttccctccttctgctggagcattcaacagcagctatgcttatttcttga 745
>emb|BX830494.1|CNS09ZWJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB85ZG04 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1701
Score = 42.1 bits (21), Expect = 0.14
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 172 ttcccgccgtctgctggggcgttcaacagcagctacgcctacttcttga 220
||||| || |||||||| || |||||||||||||| || || |||||||
Sbjct: 556 ttccctccttctgctggagcattcaacagcagctatgcttatttcttga 604
>dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MIK19
Length = 84129
Score = 42.1 bits (21), Expect = 0.14
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 172 ttcccgccgtctgctggggcgttcaacagcagctacgcctacttcttga 220
||||| || |||||||| || |||||||||||||| || || |||||||
Sbjct: 6440 ttccctccttctgctggagcattcaacagcagctatgcttatttcttga 6488
>ref|NM_125042.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT5G56590 mRNA, complete cds
Length = 1772
Score = 42.1 bits (21), Expect = 0.14
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 172 ttcccgccgtctgctggggcgttcaacagcagctacgcctacttcttga 220
||||| || |||||||| || |||||||||||||| || || |||||||
Sbjct: 697 ttccctccttctgctggagcattcaacagcagctatgcttatttcttga 745
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 42.1 bits (21), Expect = 0.14
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 172 ttcccgccgtctgctggggcgttcaacagcagctacgcctacttcttga 220
||||| || |||||||| || |||||||||||||| || || |||||||
Sbjct: 22925461 ttccctccttctgctggagcattcaacagcagctatgcttatttcttga 22925509
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 302,203
Number of Sequences: 1013581
Number of extensions: 302203
Number of successful extensions: 24602
Number of sequences better than 0.5: 26
Number of HSP's better than 0.5 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24182
Number of HSP's gapped (non-prelim): 420
length of query: 786
length of database: 908,940,872
effective HSP length: 20
effective length of query: 766
effective length of database: 888,669,252
effective search space: 680720647032
effective search space used: 680720647032
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)