BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3336914.2.1
(1448 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BH910261.1|BH910261 SALK_058682.56.00.x Arabidopsis thal... 42 0.26
gb|CC055845.1|CC055845 SALK_097729.36.00.x Arabidopsis thal... 42 0.26
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 42 0.26
emb|AL035709.1|ATT28I19 Arabidopsis thaliana DNA chromosome... 42 0.26
emb|AL161592.2|ATCHRIV88 Arabidopsis thaliana DNA chromosom... 42 0.26
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 42 0.26
>gb|BH910261.1|BH910261 SALK_058682.56.00.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_058682.56.00.x,
DNA sequence
Length = 260
Score = 42.1 bits (21), Expect = 0.26
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 655 agcaggaggaggagcgtggtg 675
|||||||||||||||||||||
Sbjct: 103 agcaggaggaggagcgtggtg 83
>gb|CC055845.1|CC055845 SALK_097729.36.00.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_097729.36.00.x,
DNA sequence
Length = 416
Score = 42.1 bits (21), Expect = 0.26
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 655 agcaggaggaggagcgtggtg 675
|||||||||||||||||||||
Sbjct: 126 agcaggaggaggagcgtggtg 106
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 42.1 bits (21), Expect = 0.26
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 655 agcaggaggaggagcgtggtg 675
|||||||||||||||||||||
Sbjct: 13643156 agcaggaggaggagcgtggtg 13643176
>emb|AL035709.1|ATT28I19 Arabidopsis thaliana DNA chromosome 4, BAC clone T28I19 (ESSA project)
Length = 110766
Score = 42.1 bits (21), Expect = 0.26
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 655 agcaggaggaggagcgtggtg 675
|||||||||||||||||||||
Sbjct: 29097 agcaggaggaggagcgtggtg 29117
>emb|AL161592.2|ATCHRIV88 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 88
Length = 198493
Score = 42.1 bits (21), Expect = 0.26
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 655 agcaggaggaggagcgtggtg 675
|||||||||||||||||||||
Sbjct: 32800 agcaggaggaggagcgtggtg 32820
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 42.1 bits (21), Expect = 0.26
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 655 agcaggaggaggagcgtggtg 675
|||||||||||||||||||||
Sbjct: 17730361 agcaggaggaggagcgtggtg 17730381
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 435,572
Number of Sequences: 1013581
Number of extensions: 435572
Number of successful extensions: 28488
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28251
Number of HSP's gapped (non-prelim): 237
length of query: 1448
length of database: 908,940,872
effective HSP length: 21
effective length of query: 1427
effective length of database: 887,655,671
effective search space: 1266684642517
effective search space used: 1266684642517
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)