BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3148257.2.1
(675 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CD531728.1|CD531728 11N08 Arabidopsis Leaf Senescence Li... 50 5e-004
gb|AF162444.1|T32N4 Arabidopsis thaliana BAC T32N4 50 5e-004
emb|AX059538.1| Sequence 271 from Patent WO0055325 50 5e-004
gb|AY050990.1| Arabidopsis thaliana putative glucan synthas... 50 5e-004
gb|AC012392.1|AC012392 Genomic Sequence For Arabidopsis tha... 50 5e-004
emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, shor... 50 5e-004
emb|AL161502.2|ATCHRIV14 Arabidopsis thaliana DNA chromosom... 50 5e-004
ref|NM_116736.1| Arabidopsis thaliana ATGSL1 (GLUCAN SYNTHA... 50 5e-004
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 50 5e-004
emb|AL091425.1|CNS00UTF Arabidopsis thaliana genome survey ... 46 0.008
gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M... 42 0.12
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 42 0.12
>gb|CD531728.1|CD531728 11N08 Arabidopsis Leaf Senescence Library Arabidopsis thaliana cDNA
3', mRNA sequence
Length = 534
Score = 50.1 bits (25), Expect = 5e-004
Identities = 70/85 (82%)
Strand = Plus / Plus
Query: 286 ttatggcaccagttgcattgctgtcctggttgccgggatttcaagaaatgcagacaaggg 345
||||||| |||||||||||||| || |||||||| || ||||| | ||||| ||| ||
Sbjct: 329 ttatggctccagttgcattgctttcatggttgcccggttttcagaatatgcaaacacgga 388
Query: 346 tacttttcaatgaaggttttagcag 370
| | |||||||||| |||||||||
Sbjct: 389 ttttgttcaatgaagcttttagcag 413
>gb|AF162444.1|T32N4 Arabidopsis thaliana BAC T32N4
Length = 80196
Score = 50.1 bits (25), Expect = 5e-004
Identities = 70/85 (82%)
Strand = Plus / Plus
Query: 286 ttatggcaccagttgcattgctgtcctggttgccgggatttcaagaaatgcagacaaggg 345
||||||| |||||||||||||| || |||||||| || ||||| | ||||| ||| ||
Sbjct: 12794 ttatggctccagttgcattgctttcatggttgcccggttttcagaatatgcaaacacgga 12853
Query: 346 tacttttcaatgaaggttttagcag 370
| | |||||||||| |||||||||
Sbjct: 12854 ttttgttcaatgaagcttttagcag 12878
>emb|AX059538.1| Sequence 271 from Patent WO0055325
Length = 47489
Score = 50.1 bits (25), Expect = 5e-004
Identities = 70/85 (82%)
Strand = Plus / Plus
Query: 286 ttatggcaccagttgcattgctgtcctggttgccgggatttcaagaaatgcagacaaggg 345
||||||| |||||||||||||| || |||||||| || ||||| | ||||| ||| ||
Sbjct: 3297 ttatggctccagttgcattgctttcatggttgcccggttttcagaatatgcaaacacgga 3356
Query: 346 tacttttcaatgaaggttttagcag 370
| | |||||||||| |||||||||
Sbjct: 3357 ttttgttcaatgaagcttttagcag 3381
>gb|AY050990.1| Arabidopsis thaliana putative glucan synthase (At4g04970) mRNA,
partial cds
Length = 1764
Score = 50.1 bits (25), Expect = 5e-004
Identities = 70/85 (82%)
Strand = Plus / Plus
Query: 286 ttatggcaccagttgcattgctgtcctggttgccgggatttcaagaaatgcagacaaggg 345
||||||| |||||||||||||| || |||||||| || ||||| | ||||| ||| ||
Sbjct: 1098 ttatggctccagttgcattgctttcatggttgcccggttttcagaatatgcaaacacgga 1157
Query: 346 tacttttcaatgaaggttttagcag 370
| | |||||||||| |||||||||
Sbjct: 1158 ttttgttcaatgaagcttttagcag 1182
>gb|AC012392.1|AC012392 Genomic Sequence For Arabidopsis thaliana clone C17L7, Chromosome IV,
complete sequence
Length = 183147
Score = 50.1 bits (25), Expect = 5e-004
Identities = 70/85 (82%)
Strand = Plus / Minus
Query: 286 ttatggcaccagttgcattgctgtcctggttgccgggatttcaagaaatgcagacaaggg 345
||||||| |||||||||||||| || |||||||| || ||||| | ||||| ||| ||
Sbjct: 178790 ttatggctccagttgcattgctttcatggttgcccggttttcagaatatgcaaacacgga 178731
Query: 346 tacttttcaatgaaggttttagcag 370
| | |||||||||| |||||||||
Sbjct: 178730 ttttgttcaatgaagcttttagcag 178706
>emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, short arm
Length = 3052119
Score = 50.1 bits (25), Expect = 5e-004
Identities = 70/85 (82%)
Strand = Plus / Plus
Query: 286 ttatggcaccagttgcattgctgtcctggttgccgggatttcaagaaatgcagacaaggg 345
||||||| |||||||||||||| || |||||||| || ||||| | ||||| ||| ||
Sbjct: 2541122 ttatggctccagttgcattgctttcatggttgcccggttttcagaatatgcaaacacgga 2541181
Query: 346 tacttttcaatgaaggttttagcag 370
| | |||||||||| |||||||||
Sbjct: 2541182 ttttgttcaatgaagcttttagcag 2541206
>emb|AL161502.2|ATCHRIV14 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 14
Length = 198563
Score = 50.1 bits (25), Expect = 5e-004
Identities = 70/85 (82%)
Strand = Plus / Plus
Query: 286 ttatggcaccagttgcattgctgtcctggttgccgggatttcaagaaatgcagacaaggg 345
||||||| |||||||||||||| || |||||||| || ||||| | ||||| ||| ||
Sbjct: 74319 ttatggctccagttgcattgctttcatggttgcccggttttcagaatatgcaaacacgga 74378
Query: 346 tacttttcaatgaaggttttagcag 370
| | |||||||||| |||||||||
Sbjct: 74379 ttttgttcaatgaagcttttagcag 74403
>ref|NM_116736.1| Arabidopsis thaliana ATGSL1 (GLUCAN SYNTHASE LIKE-1); 1,3-beta-glucan
synthase/ transferase, transferring glycosyl groups
AT4G04970 (ATGSL1) mRNA, complete cds
Length = 5827
Score = 50.1 bits (25), Expect = 5e-004
Identities = 70/85 (82%)
Strand = Plus / Plus
Query: 286 ttatggcaccagttgcattgctgtcctggttgccgggatttcaagaaatgcagacaaggg 345
||||||| |||||||||||||| || |||||||| || ||||| | ||||| ||| ||
Sbjct: 5177 ttatggctccagttgcattgctttcatggttgcccggttttcagaatatgcaaacacgga 5236
Query: 346 tacttttcaatgaaggttttagcag 370
| | |||||||||| |||||||||
Sbjct: 5237 ttttgttcaatgaagcttttagcag 5261
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 50.1 bits (25), Expect = 5e-004
Identities = 70/85 (82%)
Strand = Plus / Plus
Query: 286 ttatggcaccagttgcattgctgtcctggttgccgggatttcaagaaatgcagacaaggg 345
||||||| |||||||||||||| || |||||||| || ||||| | ||||| ||| ||
Sbjct: 2542302 ttatggctccagttgcattgctttcatggttgcccggttttcagaatatgcaaacacgga 2542361
Query: 346 tacttttcaatgaaggttttagcag 370
| | |||||||||| |||||||||
Sbjct: 2542362 ttttgttcaatgaagcttttagcag 2542386
>emb|AL091425.1|CNS00UTF Arabidopsis thaliana genome survey sequence SP6 end of BAC T7O15 of
TAMU library from strain Columbia of Arabidopsis
thaliana, genomic survey sequence
Length = 288
Score = 46.1 bits (23), Expect = 0.008
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 286 ttatggcaccagttgcattgctgtcctggttgccgggatttca 328
||||||| |||||||||||||| || |||||||| || |||||
Sbjct: 72 ttatggctccagttgcattgctttcatggttgcccggttttca 30
>gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 map CIC10A06, complete
sequence
Length = 108847
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 397 ctgggaaaagaacaaatacag 417
|||||||||||||||||||||
Sbjct: 87440 ctgggaaaagaacaaatacag 87420
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 397 ctgggaaaagaacaaatacag 417
|||||||||||||||||||||
Sbjct: 16725857 ctgggaaaagaacaaatacag 16725837
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 308,872
Number of Sequences: 1013581
Number of extensions: 308872
Number of successful extensions: 20989
Number of sequences better than 0.5: 12
Number of HSP's better than 0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20682
Number of HSP's gapped (non-prelim): 307
length of query: 675
length of database: 908,940,872
effective HSP length: 20
effective length of query: 655
effective length of database: 888,669,252
effective search space: 582078360060
effective search space used: 582078360060
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)