BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3115190.2.1
         (656 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC004255.1|AC004255  Arabidopsis thaliana BAC T1F9 chromo...    40   0.47 
gb|AE005173.1|  Arabidopsis thaliana chromosome 1, bottom ar...    40   0.47 
ref|NC_003070.5|  Arabidopsis thaliana chromosome 1, complet...    40   0.47 

>gb|AC004255.1|AC004255 Arabidopsis thaliana BAC T1F9 chromosome 1, complete sequence
          Length = 97789

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 48   ataagtattatatttatttt 67
            ||||||||||||||||||||
Sbjct: 7846 ataagtattatatttatttt 7865



>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
          Length = 14668883

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 48      ataagtattatatttatttt 67
               ||||||||||||||||||||
Sbjct: 6925924 ataagtattatatttatttt 6925905



>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
          Length = 30432563

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 48       ataagtattatatttatttt 67
                ||||||||||||||||||||
Sbjct: 22688273 ataagtattatatttatttt 22688254



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 269,995
Number of Sequences: 1013581
Number of extensions: 269995
Number of successful extensions: 20020
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19768
Number of HSP's gapped (non-prelim): 252
length of query: 656
length of database: 908,940,872
effective HSP length: 20
effective length of query: 636
effective length of database: 888,669,252
effective search space: 565193644272
effective search space used: 565193644272
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)