BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3115097.2.2
         (1086 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AF083687.1|  Arabidopsis thaliana clone sps111 unknown mRNA     46   0.013
dbj|AK175875.1|  Arabidopsis thaliana mRNA for expansin-like...    46   0.013
ref|NM_115407.2|  Arabidopsis thaliana ATEXPA16 (ARABIDOPSIS...    46   0.013
gb|AF027174.1|AF027174  Arabidopsis thaliana cellulose synth...    42   0.20 
gb|AF043351.1|AF043351  Arabidopsis thaliana adenosine-5'-ph...    42   0.20 
gb|AF029262.1|AF029262  Arabidopsis thaliana putative cdc20 ...    42   0.20 
gb|AF029263.1|AF029263  Arabidopsis thaliana putative cdc20 ...    42   0.20 
dbj|AB014459.1|  Arabidopsis thaliana mRNA for obtusifoliol ...    42   0.20 
dbj|BD022678.1|  Manipulation of cellulose and/or beta-1,4-g...    42   0.20 
emb|AX030946.1|  Sequence 9 from Patent WO9800549                  42   0.20 
>gb|AF083687.1| Arabidopsis thaliana clone sps111 unknown mRNA
          Length = 638

 Score = 46.1 bits (23), Expect = 0.013
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 525 gccggcatcgtgcccatctcctaccgcagggtggc 559
           |||||||| || |||||||| ||||||||||||||
Sbjct: 489 gccggcattgtccccatctcttaccgcagggtggc 523
>dbj|AK175875.1| Arabidopsis thaliana mRNA for expansin-like protein, complete cds,
           clone: RAFL22-51-G11
          Length = 1115

 Score = 46.1 bits (23), Expect = 0.013
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 525 gccggcatcgtgcccatctcctaccgcagggtggc 559
           |||||||| || |||||||| ||||||||||||||
Sbjct: 525 gccggcattgtccccatctcttaccgcagggtggc 559
>ref|NM_115407.2| Arabidopsis thaliana ATEXPA16 (ARABIDOPSIS THALIANA EXPANSIN A16)
           AT3G55500 (ATEXPA16) mRNA, complete cds
          Length = 827

 Score = 46.1 bits (23), Expect = 0.013
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 525 gccggcatcgtgcccatctcctaccgcagggtggc 559
           |||||||| || |||||||| ||||||||||||||
Sbjct: 489 gccggcattgtccccatctcttaccgcagggtggc 523
>gb|AF027174.1|AF027174 Arabidopsis thaliana cellulose synthase catalytic subunit (Ath-B)
          mRNA, complete cds
          Length = 3682

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 2  gaattcgcggccgcgtcgact 22
          |||||||||||||||||||||
Sbjct: 40 gaattcgcggccgcgtcgact 60
>gb|AF043351.1|AF043351 Arabidopsis thaliana adenosine-5'-phosphosulfate-kinase (akn2) mRNA,
            complete cds
          Length = 1311

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 2    gaattcgcggccgcgtcgact 22
            |||||||||||||||||||||
Sbjct: 1254 gaattcgcggccgcgtcgact 1234
>gb|AF029262.1|AF029262 Arabidopsis thaliana putative cdc20 protein (CDC20.1) mRNA,
          complete cds
          Length = 1848

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 2  gaattcgcggccgcgtcgact 22
          |||||||||||||||||||||
Sbjct: 1  gaattcgcggccgcgtcgact 21
>gb|AF029263.1|AF029263 Arabidopsis thaliana putative cdc20 protein (CDC20.2) mRNA,
          complete cds
          Length = 1790

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 2  gaattcgcggccgcgtcgact 22
          |||||||||||||||||||||
Sbjct: 1  gaattcgcggccgcgtcgact 21
>dbj|AB014459.1| Arabidopsis thaliana mRNA for obtusifoliol 14-demethylase,
          complete cds
          Length = 1899

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 1  cgaattcgcggccgcgtcgac 21
          |||||||||||||||||||||
Sbjct: 52 cgaattcgcggccgcgtcgac 72
>dbj|BD022678.1| Manipulation of cellulose and/or beta-1,4-glucan
          Length = 3614

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 2  gaattcgcggccgcgtcgact 22
          |||||||||||||||||||||
Sbjct: 1  gaattcgcggccgcgtcgact 21
>emb|AX030946.1| Sequence 9 from Patent WO9800549
          Length = 3614

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 2  gaattcgcggccgcgtcgact 22
          |||||||||||||||||||||
Sbjct: 1  gaattcgcggccgcgtcgact 21
  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 315,031
Number of Sequences: 1013581
Number of extensions: 315031
Number of successful extensions: 25579
Number of sequences better than  0.5: 10
Number of HSP's better than  0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25565
Number of HSP's gapped (non-prelim): 14
length of query: 1086
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1066
effective length of database: 888,669,252
effective search space: 947321422632
effective search space used: 947321422632
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)