BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3115097.2.2
(1086 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF083687.1| Arabidopsis thaliana clone sps111 unknown mRNA 46 0.013
dbj|AK175875.1| Arabidopsis thaliana mRNA for expansin-like... 46 0.013
ref|NM_115407.2| Arabidopsis thaliana ATEXPA16 (ARABIDOPSIS... 46 0.013
gb|AF027174.1|AF027174 Arabidopsis thaliana cellulose synth... 42 0.20
gb|AF043351.1|AF043351 Arabidopsis thaliana adenosine-5'-ph... 42 0.20
gb|AF029262.1|AF029262 Arabidopsis thaliana putative cdc20 ... 42 0.20
gb|AF029263.1|AF029263 Arabidopsis thaliana putative cdc20 ... 42 0.20
dbj|AB014459.1| Arabidopsis thaliana mRNA for obtusifoliol ... 42 0.20
dbj|BD022678.1| Manipulation of cellulose and/or beta-1,4-g... 42 0.20
emb|AX030946.1| Sequence 9 from Patent WO9800549 42 0.20
>gb|AF083687.1| Arabidopsis thaliana clone sps111 unknown mRNA
Length = 638
Score = 46.1 bits (23), Expect = 0.013
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 525 gccggcatcgtgcccatctcctaccgcagggtggc 559
|||||||| || |||||||| ||||||||||||||
Sbjct: 489 gccggcattgtccccatctcttaccgcagggtggc 523
>dbj|AK175875.1| Arabidopsis thaliana mRNA for expansin-like protein, complete cds,
clone: RAFL22-51-G11
Length = 1115
Score = 46.1 bits (23), Expect = 0.013
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 525 gccggcatcgtgcccatctcctaccgcagggtggc 559
|||||||| || |||||||| ||||||||||||||
Sbjct: 525 gccggcattgtccccatctcttaccgcagggtggc 559
>ref|NM_115407.2| Arabidopsis thaliana ATEXPA16 (ARABIDOPSIS THALIANA EXPANSIN A16)
AT3G55500 (ATEXPA16) mRNA, complete cds
Length = 827
Score = 46.1 bits (23), Expect = 0.013
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 525 gccggcatcgtgcccatctcctaccgcagggtggc 559
|||||||| || |||||||| ||||||||||||||
Sbjct: 489 gccggcattgtccccatctcttaccgcagggtggc 523
>gb|AF027174.1|AF027174 Arabidopsis thaliana cellulose synthase catalytic subunit (Ath-B)
mRNA, complete cds
Length = 3682
Score = 42.1 bits (21), Expect = 0.20
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 2 gaattcgcggccgcgtcgact 22
|||||||||||||||||||||
Sbjct: 40 gaattcgcggccgcgtcgact 60
>gb|AF043351.1|AF043351 Arabidopsis thaliana adenosine-5'-phosphosulfate-kinase (akn2) mRNA,
complete cds
Length = 1311
Score = 42.1 bits (21), Expect = 0.20
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 2 gaattcgcggccgcgtcgact 22
|||||||||||||||||||||
Sbjct: 1254 gaattcgcggccgcgtcgact 1234
>gb|AF029262.1|AF029262 Arabidopsis thaliana putative cdc20 protein (CDC20.1) mRNA,
complete cds
Length = 1848
Score = 42.1 bits (21), Expect = 0.20
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 2 gaattcgcggccgcgtcgact 22
|||||||||||||||||||||
Sbjct: 1 gaattcgcggccgcgtcgact 21
>gb|AF029263.1|AF029263 Arabidopsis thaliana putative cdc20 protein (CDC20.2) mRNA,
complete cds
Length = 1790
Score = 42.1 bits (21), Expect = 0.20
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 2 gaattcgcggccgcgtcgact 22
|||||||||||||||||||||
Sbjct: 1 gaattcgcggccgcgtcgact 21
>dbj|AB014459.1| Arabidopsis thaliana mRNA for obtusifoliol 14-demethylase,
complete cds
Length = 1899
Score = 42.1 bits (21), Expect = 0.20
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 cgaattcgcggccgcgtcgac 21
|||||||||||||||||||||
Sbjct: 52 cgaattcgcggccgcgtcgac 72
>dbj|BD022678.1| Manipulation of cellulose and/or beta-1,4-glucan
Length = 3614
Score = 42.1 bits (21), Expect = 0.20
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 2 gaattcgcggccgcgtcgact 22
|||||||||||||||||||||
Sbjct: 1 gaattcgcggccgcgtcgact 21
>emb|AX030946.1| Sequence 9 from Patent WO9800549
Length = 3614
Score = 42.1 bits (21), Expect = 0.20
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 2 gaattcgcggccgcgtcgact 22
|||||||||||||||||||||
Sbjct: 1 gaattcgcggccgcgtcgact 21
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 315,031
Number of Sequences: 1013581
Number of extensions: 315031
Number of successful extensions: 25579
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25565
Number of HSP's gapped (non-prelim): 14
length of query: 1086
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1066
effective length of database: 888,669,252
effective search space: 947321422632
effective search space used: 947321422632
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)