BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3071761.2.1
         (638 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC005957.3|  Arabidopsis thaliana chromosome 2 clone T15J...    40   0.45 
emb|BX819827.1|CNS0A9GP  Arabidopsis thaliana Full-length cD...    40   0.45 
ref|NC_003071.3|  Arabidopsis thaliana chromosome 2, complet...    40   0.45 

>gb|AC005957.3| Arabidopsis thaliana chromosome 2 clone T15J14 map mi398, complete
             sequence
          Length = 114041

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 128   gaccttgctggtgaaatccc 147
             ||||||||||||||||||||
Sbjct: 53502 gaccttgctggtgaaatccc 53521



>emb|BX819827.1|CNS0A9GP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS32ZH08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1374

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 128 gaccttgctggtgaaatccc 147
           ||||||||||||||||||||
Sbjct: 618 gaccttgctggtgaaatccc 599



>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
          Length = 19705359

 Score = 40.1 bits (20), Expect = 0.45
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 128     gaccttgctggtgaaatccc 147
               ||||||||||||||||||||
Sbjct: 6515261 gaccttgctggtgaaatccc 6515280



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 265,836
Number of Sequences: 1013581
Number of extensions: 265836
Number of successful extensions: 18798
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18679
Number of HSP's gapped (non-prelim): 119
length of query: 638
length of database: 908,940,872
effective HSP length: 20
effective length of query: 618
effective length of database: 888,669,252
effective search space: 549197597736
effective search space used: 549197597736
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)