BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3012915.2.2
(621 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE037598.1|BE037598 AA01F08 AA Arabidopsis thaliana cDNA... 40 0.44
>gb|BE037598.1|BE037598 AA01F08 AA Arabidopsis thaliana cDNA 5' similar to lhcb6 protein
- chlorophyll binding, mRNA sequence
Length = 880
Score = 40.1 bits (20), Expect = 0.44
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 2 tgcaggaattcggcaccaggctcc 25
|||||||||||||||| |||||||
Sbjct: 8 tgcaggaattcggcacgaggctcc 31
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 150,478
Number of Sequences: 1013581
Number of extensions: 150478
Number of successful extensions: 10542
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10541
Number of HSP's gapped (non-prelim): 1
length of query: 621
length of database: 908,940,872
effective HSP length: 20
effective length of query: 601
effective length of database: 888,669,252
effective search space: 534090220452
effective search space used: 534090220452
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)