BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2943856.2.2
(661 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF075598.1|T24H24 Arabidopsis thaliana BAC T24H24 44 0.030
emb|AX059526.1| Sequence 259 from Patent WO0055325 44 0.030
emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, shor... 44 0.030
emb|AL161499.2|ATCHRIV11 Arabidopsis thaliana DNA chromosom... 44 0.030
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 44 0.030
gb|BX836823.1|BX836823 BX836823 Arabidopsis thaliana Adult ... 42 0.12
gb|BP813491.1|BP813491 BP813491 RAFL19 Arabidopsis thaliana... 42 0.12
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 42 0.12
emb|AL079349.2|ATF25G13 Arabidopsis thaliana DNA chromosome... 42 0.12
emb|AL161535.2|ATCHRIV35 Arabidopsis thaliana DNA chromosom... 42 0.12
gb|B18494.1|B18494 F9K20-T7 IGF Arabidopsis thaliana genomi... 40 0.47
emb|AL094435.1|CNS00X51 Arabidopsis thaliana genome survey ... 40 0.47
gb|AQ956755.1|AQ956755 LERAL87TF LERA Arabidopsis thaliana ... 40 0.47
gb|BH618619.1|BH618619 SALK_039421 Arabidopsis thaliana TDN... 40 0.47
gb|BH750347.1|BH750347 SALK_038222.43.35.x Arabidopsis thal... 40 0.47
gb|BH811505.1|BH811505 SALK_059006 Arabidopsis thaliana TDN... 40 0.47
gb|BZ290853.1|BZ290853 SALK_092933.35.45.x Arabidopsis thal... 40 0.47
gb|CL466885.1|CL466885 SAIL_1263_A09.v1 SAIL Collection Ara... 40 0.47
gb|CL486523.1|CL486523 SAIL_436_D10.v1 SAIL Collection Arab... 40 0.47
emb|BX004687.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.47
emb|BX653373.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.47
gb|H77210.1|H77210 17641 Lambda-PRL2 Arabidopsis thaliana c... 40 0.47
gb|AU228882.1|AU228882 AU228882 RAFL16 Arabidopsis thaliana... 40 0.47
gb|AV786432.1|AV786432 AV786432 RAFL6 Arabidopsis thaliana ... 40 0.47
gb|AV822832.1|AV822832 AV822832 RAFL5 Arabidopsis thaliana ... 40 0.47
gb|AV827292.1|AV827292 AV827292 RAFL9 Arabidopsis thaliana ... 40 0.47
gb|AU235721.1|AU235721 AU235721 RAFL14 Arabidopsis thaliana... 40 0.47
gb|CB074341.1|CB074341 EST00856 Virulent Peronospora parasi... 40 0.47
gb|CB255845.1|CB255845 17-E011664-027-006-A06-T7R MPIZ-ADIS... 40 0.47
gb|CB257034.1|CB257034 49-E012742-027-007-A14-T7R MPIZ-ADIS... 40 0.47
gb|CB258360.1|CB258360 33-E011137-014-001-A09-T7R MPIZ-ADIS... 40 0.47
gb|BX837853.1|BX837853 BX837853 Arabidopsis thaliana Hormon... 40 0.47
gb|BX838156.1|BX838156 BX838156 Arabidopsis thaliana Hormon... 40 0.47
gb|BX838842.1|BX838842 BX838842 Arabidopsis thaliana Flower... 40 0.47
gb|AV528901.1|AV528901 AV528901 Arabidopsis thaliana aboveg... 40 0.47
gb|AV529580.1|AV529580 AV529580 Arabidopsis thaliana aboveg... 40 0.47
gb|AV534103.1|AV534103 AV534103 Arabidopsis thaliana flower... 40 0.47
gb|AV536671.1|AV536671 AV536671 Arabidopsis thaliana liquid... 40 0.47
gb|BP572372.1|BP572372 BP572372 RAFL14 Arabidopsis thaliana... 40 0.47
gb|BP576585.1|BP576585 BP576585 RAFL14 Arabidopsis thaliana... 40 0.47
gb|BP581690.1|BP581690 BP581690 RAFL14 Arabidopsis thaliana... 40 0.47
gb|BP583343.1|BP583343 BP583343 RAFL14 Arabidopsis thaliana... 40 0.47
gb|CB253948.1|CB253948 82-E018429-019-008-D21-T7R MPIZ-ADIS... 40 0.47
gb|BP799823.1|BP799823 BP799823 RAFL14 Arabidopsis thaliana... 40 0.47
gb|BP801140.1|BP801140 BP801140 RAFL14 Arabidopsis thaliana... 40 0.47
gb|BP803203.1|BP803203 BP803203 RAFL14 Arabidopsis thaliana... 40 0.47
gb|BP814745.1|BP814745 BP814745 RAFL19 Arabidopsis thaliana... 40 0.47
gb|BP821604.1|BP821604 BP821604 RAFL19 Arabidopsis thaliana... 40 0.47
gb|BP821954.1|BP821954 BP821954 RAFL19 Arabidopsis thaliana... 40 0.47
gb|BP832414.1|BP832414 BP832414 RAFL19 Arabidopsis thaliana... 40 0.47
gb|BP842517.1|BP842517 BP842517 RAFL21 Arabidopsis thaliana... 40 0.47
gb|BP854278.1|BP854278 BP854278 RAFL21 Arabidopsis thaliana... 40 0.47
gb|BP859115.1|BP859115 BP859115 RAFL21 Arabidopsis thaliana... 40 0.47
gb|BP866626.1|BP866626 BP866626 RAFL21 Arabidopsis thaliana... 40 0.47
gb|DR750659.1|DR750659 45-L022243-065-008-E06-SeLB MPIZ-ADI... 40 0.47
emb|AL049914.1|F6E21 Arabidopsis thaliana clone F6E21, *** ... 40 0.47
emb|A75961.1| Sequence 3 from Patent WO9321326 40 0.47
gb|AF367288.1|AF367288 Arabidopsis thaliana AT4g30210/F9N11... 40 0.47
gb|AF325101.1|AF325101 Arabidopsis thaliana NADPH-ferrihemo... 40 0.47
gb|AY120712.1| Arabidopsis thaliana DEAD box RNA helicase R... 40 0.47
gb|AY074353.1| Arabidopsis thaliana putative 98b protein (A... 40 0.47
gb|AY096398.1| Arabidopsis thaliana putative 98b protein (A... 40 0.47
gb|AY125491.1| Arabidopsis thaliana putative 98b protein (A... 40 0.47
emb|AX505390.1| Sequence 85 from Patent WO0216655 40 0.47
emb|AX506108.1| Sequence 803 from Patent WO0216655 40 0.47
emb|AX651759.1| Sequence 605 from Patent WO03000898 40 0.47
gb|AC008262.4|AC008262 Genomic sequence for Arabidopsis tha... 40 0.47
gb|AC018364.5|AC018364 Arabidopsis thaliana chromosome 1 BA... 40 0.47
emb|BX827591.1|CNS0A2CR Arabidopsis thaliana Full-length cD... 40 0.47
emb|BX823866.1|CNS0A4PS Arabidopsis thaliana Full-length cD... 40 0.47
emb|BX814173.1|CNS0AC9C Arabidopsis thaliana Full-length cD... 40 0.47
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 40 0.47
emb|AJ010464.1|ATH010464 Arabidopsis thaliana mRNA for DEAD... 40 0.47
emb|AL035394.1|ATF9D16 Arabidopsis thaliana DNA chromosome ... 40 0.47
emb|AL078468.1|ATT32A16 Arabidopsis thaliana DNA chromosome... 40 0.47
emb|AL109796.1|ATF9N11 Arabidopsis thaliana DNA chromosome ... 40 0.47
emb|AL137898.1|ATT20K12 Arabidopsis thaliana DNA chromosome... 40 0.47
emb|AL161560.2|ATCHRIV60 Arabidopsis thaliana DNA chromosom... 40 0.47
emb|AL161576.2|ATCHRIV72 Arabidopsis thaliana DNA chromosom... 40 0.47
emb|AL161578.2|ATCHRIV74 Arabidopsis thaliana DNA chromosom... 40 0.47
emb|X66017.1|ATATR2M A.thaliana mRNA ATR2 for NADPH-cytochr... 40 0.47
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 40 0.47
ref|NM_118511.2| Arabidopsis thaliana transcription factor ... 40 0.47
ref|NM_179141.1| Arabidopsis thaliana ATR2 AT4G30210 (ATR2)... 40 0.47
ref|NM_119167.2| Arabidopsis thaliana ATR2 AT4G30210 (ATR2)... 40 0.47
ref|NM_119260.3| Arabidopsis thaliana kinase AT4G31100 mRNA... 40 0.47
ref|NM_119261.2| Arabidopsis thaliana kinase AT4G31110 mRNA... 40 0.47
ref|NM_115988.2| Arabidopsis thaliana ATP binding / ATP-dep... 40 0.47
ref|NM_105592.3| Arabidopsis thaliana RNA binding / nucleic... 40 0.47
ref|NM_202382.1| Arabidopsis thaliana RNA binding / protein... 40 0.47
ref|NM_202743.1| Arabidopsis thaliana ATP binding / ATP-dep... 40 0.47
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 40 0.47
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 40 0.47
>gb|AF075598.1|T24H24 Arabidopsis thaliana BAC T24H24
Length = 88848
Score = 44.1 bits (22), Expect = 0.030
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 470 aaagagaattggattattataaaatt 495
|||||||||| |||||||||||||||
Sbjct: 13448 aaagagaatttgattattataaaatt 13423
>emb|AX059526.1| Sequence 259 from Patent WO0055325
Length = 41887
Score = 44.1 bits (22), Expect = 0.030
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 470 aaagagaattggattattataaaatt 495
|||||||||| |||||||||||||||
Sbjct: 18033 aaagagaatttgattattataaaatt 18058
>emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, short arm
Length = 3052119
Score = 44.1 bits (22), Expect = 0.030
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 470 aaagagaattggattattataaaatt 495
|||||||||| |||||||||||||||
Sbjct: 1988008 aaagagaatttgattattataaaatt 1988033
>emb|AL161499.2|ATCHRIV11 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 11
Length = 198022
Score = 44.1 bits (22), Expect = 0.030
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 470 aaagagaattggattattataaaatt 495
|||||||||| |||||||||||||||
Sbjct: 103987 aaagagaatttgattattataaaatt 104012
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 44.1 bits (22), Expect = 0.030
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 470 aaagagaattggattattataaaatt 495
|||||||||| |||||||||||||||
Sbjct: 1989190 aaagagaatttgattattataaaatt 1989215
Score = 42.1 bits (21), Expect = 0.12
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttcgtcaa 398
|||||||||||||||||||| ||||
Sbjct: 7603094 tttcgttcttcttcttcttcttcaa 7603118
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 379 ttcttcttcttcttcgtcaa 398
||||||||||||||||||||
Sbjct: 15129745 ttcttcttcttcttcgtcaa 15129726
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 379 ttcttcttcttcttcgtcaa 398
||||||||||||||||||||
Sbjct: 15126285 ttcttcttcttcttcgtcaa 15126266
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 14796912 tcttcttcttcttcgtcaac 14796931
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 373 ttttcgttcttcttcttctt 392
||||||||||||||||||||
Sbjct: 12392111 ttttcgttcttcttcttctt 12392092
>gb|BX836823.1|BX836823 BX836823 Arabidopsis thaliana Adult vegetative tissue Col-0
Arabidopsis thaliana cDNA clone GSLTLS95ZB10 5PRIM, mRNA
sequence
Length = 943
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 373 ttttcgttcttcttcttcttc 393
|||||||||||||||||||||
Sbjct: 5 ttttcgttcttcttcttcttc 25
>gb|BP813491.1|BP813491 BP813491 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-06-J17 5',
mRNA sequence
Length = 487
Score = 42.1 bits (21), Expect = 0.12
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 43 ttcttcttcttcttcgtcaac 63
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 42.1 bits (21), Expect = 0.12
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttcgtcaa 398
|||||||||||||||||||| ||||
Sbjct: 3515836 tttcgttcttcttcttcttcttcaa 3515860
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 379 ttcttcttcttcttcgtcaa 398
||||||||||||||||||||
Sbjct: 11042515 ttcttcttcttcttcgtcaa 11042496
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 379 ttcttcttcttcttcgtcaa 398
||||||||||||||||||||
Sbjct: 11039055 ttcttcttcttcttcgtcaa 11039036
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 10709683 tcttcttcttcttcgtcaac 10709702
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 373 ttttcgttcttcttcttctt 392
||||||||||||||||||||
Sbjct: 8304872 ttttcgttcttcttcttctt 8304853
>emb|AL079349.2|ATF25G13 Arabidopsis thaliana DNA chromosome 4, BAC clone F25G13, partial
sequence (ESSA project)
Length = 95009
Score = 42.1 bits (21), Expect = 0.12
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttcgtcaa 398
|||||||||||||||||||| ||||
Sbjct: 54745 tttcgttcttcttcttcttcttcaa 54769
>emb|AL161535.2|ATCHRIV35 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 35
Length = 199280
Score = 42.1 bits (21), Expect = 0.12
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttcgtcaa 398
|||||||||||||||||||| ||||
Sbjct: 84119 tttcgttcttcttcttcttcttcaa 84143
>gb|B18494.1|B18494 F9K20-T7 IGF Arabidopsis thaliana genomic clone F9K20, DNA sequence
Length = 848
Score = 40.1 bits (20), Expect = 0.47
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 364 ctttctttattttcgttcttcttcttct 391
|||||||| ||||| |||||||||||||
Sbjct: 505 ctttcttttttttctttcttcttcttct 532
>emb|AL094435.1|CNS00X51 Arabidopsis thaliana genome survey sequence SP6 end of BAC T13D12
of TAMU library from strain Columbia of Arabidopsis
thaliana, genomic survey sequence
Length = 440
Score = 40.1 bits (20), Expect = 0.47
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaacaca 402
|||||||||||||||||| |||||
Sbjct: 62 ttcttcttcttcttcgtcgacaca 85
>gb|AQ956755.1|AQ956755 LERAL87TF LERA Arabidopsis thaliana genomic clone LERAL87, DNA
sequence
Length = 686
Score = 40.1 bits (20), Expect = 0.47
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 372 attttcgttcttcttcttcttcgt 395
|||||| |||||||||||||||||
Sbjct: 151 attttctttcttcttcttcttcgt 174
>gb|BH618619.1|BH618619 SALK_039421 Arabidopsis thaliana TDNA insertion lines Arabidopsis
thaliana genomic clone SALK_039421, DNA sequence
Length = 424
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 174 tcttcttcttcttcgtcaac 193
>gb|BH750347.1|BH750347 SALK_038222.43.35.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_038222.43.35.x,
DNA sequence
Length = 358
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 54 tttcgttcttcttcttcttc 73
>gb|BH811505.1|BH811505 SALK_059006 Arabidopsis thaliana TDNA insertion lines Arabidopsis
thaliana genomic clone SALK_059006, DNA sequence
Length = 259
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 28 tcttcttcttcttcgtcaac 47
>gb|BZ290853.1|BZ290853 SALK_092933.35.45.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_092933.35.45.x,
DNA sequence
Length = 211
Score = 40.1 bits (20), Expect = 0.47
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 472 agagaattggattattataaaatt 495
|||||||| |||||||||||||||
Sbjct: 104 agagaatttgattattataaaatt 127
>gb|CL466885.1|CL466885 SAIL_1263_A09.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_1263_A09.v1, DNA sequence
Length = 986
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 227 tttcgttcttcttcttcttc 246
>gb|CL486523.1|CL486523 SAIL_436_D10.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_436_D10.v1, DNA sequence
Length = 888
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 180 tttcgttcttcttcttcttc 199
>emb|BX004687.1| Arabidopsis thaliana T-DNA flanking sequence GK-400C08-017933,
genomic survey sequence
Length = 195
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 9 tttcgttcttcttcttcttc 28
>emb|BX653373.1| Arabidopsis thaliana T-DNA flanking sequence GK-579C09-021325,
genomic survey sequence
Length = 141
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 49 tttcgttcttcttcttcttc 68
>gb|H77210.1|H77210 17641 Lambda-PRL2 Arabidopsis thaliana cDNA clone 205D20T7, mRNA
sequence
Length = 487
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 30 tttcgttcttcttcttcttc 49
>gb|AU228882.1|AU228882 AU228882 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-57-B19 3',
mRNA sequence
Length = 427
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaa 398
||||||||||||||||||||
Sbjct: 283 ttcttcttcttcttcgtcaa 302
>gb|AV786432.1|AV786432 AV786432 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-71-G11 3',
mRNA sequence
Length = 455
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 373 ttttcgttcttcttcttctt 392
||||||||||||||||||||
Sbjct: 426 ttttcgttcttcttcttctt 445
>gb|AV822832.1|AV822832 AV822832 RAFL5 Arabidopsis thaliana cDNA clone RAFL05-12-D04 5',
mRNA sequence
Length = 673
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 110 tttcgttcttcttcttcttc 129
>gb|AV827292.1|AV827292 AV827292 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-13-I05 5',
mRNA sequence
Length = 622
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 144 tcttcttcttcttcgtcaac 163
>gb|AU235721.1|AU235721 AU235721 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-36-E12 5',
mRNA sequence
Length = 658
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 11 tttcgttcttcttcttcttc 30
>gb|CB074341.1|CB074341 EST00856 Virulent Peronospora parasitica Infected Arabidopsis
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone VPP-DB8 similar to NADPH-CYTOCHROME P450
REDUCTASE, mRNA sequence
Length = 431
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 318 tcttcttcttcttcgtcaac 299
>gb|CB255845.1|CB255845 17-E011664-027-006-A06-T7R MPIZ-ADIS-027 Arabidopsis thaliana cDNA
clone MPIZp772A066Q 5-PRIME, mRNA sequence
Length = 382
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 132 tcttcttcttcttcgtcaac 151
>gb|CB257034.1|CB257034 49-E012742-027-007-A14-T7R MPIZ-ADIS-027 Arabidopsis thaliana cDNA
clone MPIZp772A147Q 5-PRIME, mRNA sequence
Length = 684
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 33 tttcgttcttcttcttcttc 52
>gb|CB258360.1|CB258360 33-E011137-014-001-A09-T7R MPIZ-ADIS-014 Arabidopsis thaliana cDNA
clone MPIZp771A091Q 5-PRIME, mRNA sequence
Length = 479
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 88 tcttcttcttcttcgtcaac 107
>gb|BX837853.1|BX837853 BX837853 Arabidopsis thaliana Hormone Treated Callus Col-0
Arabidopsis thaliana cDNA clone GSLTPGH6ZG07 5PRIM, mRNA
sequence
Length = 1099
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 40 tttcgttcttcttcttcttc 59
>gb|BX838156.1|BX838156 BX838156 Arabidopsis thaliana Hormone Treated Callus Col-0
Arabidopsis thaliana cDNA clone GSLTPGH52ZG09 5PRIM,
mRNA sequence
Length = 887
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 38 tttcgttcttcttcttcttc 57
>gb|BX838842.1|BX838842 BX838842 Arabidopsis thaliana Flowers and buds Col-0 Arabidopsis
thaliana cDNA clone GSLTFB66ZA10 5PRIM, mRNA sequence
Length = 1060
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 132 tcttcttcttcttcgtcaac 151
>gb|AV528901.1|AV528901 AV528901 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZL22b06R 5', mRNA
sequence
Length = 281
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 130 tcttcttcttcttcgtcaac 149
>gb|AV529580.1|AV529580 AV529580 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZL41b06R 5', mRNA
sequence
Length = 379
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 81 tcttcttcttcttcgtcaac 100
>gb|AV534103.1|AV534103 AV534103 Arabidopsis thaliana flower buds Columbia Arabidopsis
thaliana cDNA clone FB074a04F 3', mRNA sequence
Length = 457
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 373 ttttcgttcttcttcttctt 392
||||||||||||||||||||
Sbjct: 380 ttttcgttcttcttcttctt 399
>gb|AV536671.1|AV536671 AV536671 Arabidopsis thaliana liquid-cultured seedlings Columbia
Arabidopsis thaliana cDNA clone pAZNII0414R 5', mRNA
sequence
Length = 421
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 112 tcttcttcttcttcgtcaac 131
>gb|BP572372.1|BP572372 BP572372 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-79-L19 3',
mRNA sequence
Length = 446
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 373 ttttcgttcttcttcttctt 392
||||||||||||||||||||
Sbjct: 392 ttttcgttcttcttcttctt 411
>gb|BP576585.1|BP576585 BP576585 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-92-J18 3',
mRNA sequence
Length = 429
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 373 ttttcgttcttcttcttctt 392
||||||||||||||||||||
Sbjct: 382 ttttcgttcttcttcttctt 401
>gb|BP581690.1|BP581690 BP581690 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-33-A08 3',
mRNA sequence
Length = 455
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 373 ttttcgttcttcttcttctt 392
||||||||||||||||||||
Sbjct: 382 ttttcgttcttcttcttctt 401
>gb|BP583343.1|BP583343 BP583343 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-40-M07 3',
mRNA sequence
Length = 443
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 373 ttttcgttcttcttcttctt 392
||||||||||||||||||||
Sbjct: 383 ttttcgttcttcttcttctt 402
>gb|CB253948.1|CB253948 82-E018429-019-008-D21-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768D218Q 5-PRIME, mRNA sequence
Length = 645
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 75 tttcgttcttcttcttcttc 94
>gb|BP799823.1|BP799823 BP799823 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-12-K06 5',
mRNA sequence
Length = 417
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 10 tttcgttcttcttcttcttc 29
>gb|BP801140.1|BP801140 BP801140 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-18-I22 5',
mRNA sequence
Length = 386
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 10 tttcgttcttcttcttcttc 29
>gb|BP803203.1|BP803203 BP803203 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-28-B21 5',
mRNA sequence
Length = 373
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 10 tttcgttcttcttcttcttc 29
>gb|BP814745.1|BP814745 BP814745 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-36-L01 5',
mRNA sequence
Length = 373
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 62 tcttcttcttcttcgtcaac 81
>gb|BP821604.1|BP821604 BP821604 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-58-J24 5',
mRNA sequence
Length = 387
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 62 tcttcttcttcttcgtcaac 81
>gb|BP821954.1|BP821954 BP821954 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-59-M02 5',
mRNA sequence
Length = 386
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 380 tcttcttcttcttcgtcaac 399
||||||||||||||||||||
Sbjct: 62 tcttcttcttcttcgtcaac 81
>gb|BP832414.1|BP832414 BP832414 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-92-I08 5',
mRNA sequence
Length = 353
Score = 40.1 bits (20), Expect = 0.47
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 89 tttcgttcttcttcttcttc 108
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 603,535
Number of Sequences: 1013581
Number of extensions: 603535
Number of successful extensions: 129772
Number of sequences better than 0.5: 93
Number of HSP's better than 0.5 without gapping: 98
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 122058
Number of HSP's gapped (non-prelim): 7682
length of query: 661
length of database: 908,940,872
effective HSP length: 20
effective length of query: 641
effective length of database: 888,669,252
effective search space: 569636990532
effective search space used: 569636990532
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)