BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2823202.2.1
(529 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CL475519.1|CL475519 SAIL_23_F10.v1 SAIL Collection Arabi... 42 0.094
gb|AV824336.1|AV824336 AV824336 RAFL6 Arabidopsis thaliana ... 40 0.37
gb|AY080632.1| Arabidopsis thaliana unknown protein (At5g59... 40 0.37
gb|BT002357.1| Arabidopsis thaliana clone C105008 unknown p... 40 0.37
gb|AY087834.1| Arabidopsis thaliana clone 38797 mRNA, compl... 40 0.37
emb|BX830735.1|CNS09YMJ Arabidopsis thaliana Full-length cD... 40 0.37
emb|BX831484.1|CNS09ZJ0 Arabidopsis thaliana Full-length cD... 40 0.37
dbj|AB025604.1| Arabidopsis thaliana genomic DNA, chromosom... 40 0.37
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 40 0.37
ref|NM_125341.2| Arabidopsis thaliana unknown protein AT5G5... 40 0.37
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 40 0.37
>gb|CL475519.1|CL475519 SAIL_23_F10.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_23_F10.v1, DNA sequence
Length = 953
Score = 42.1 bits (21), Expect = 0.094
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 345 gaggagtgggtggggaggggc 365
|||||||||||||||||||||
Sbjct: 786 gaggagtgggtggggaggggc 766
>gb|AV824336.1|AV824336 AV824336 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-68-B19 5',
mRNA sequence
Length = 383
Score = 40.1 bits (20), Expect = 0.37
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 424 tattgtaacttcagtcttca 443
||||||||||||||||||||
Sbjct: 154 tattgtaacttcagtcttca 173
>gb|AY080632.1| Arabidopsis thaliana unknown protein (At5g59500) mRNA, partial cds
Length = 978
Score = 40.1 bits (20), Expect = 0.37
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 424 tattgtaacttcagtcttca 443
||||||||||||||||||||
Sbjct: 156 tattgtaacttcagtcttca 175
>gb|BT002357.1| Arabidopsis thaliana clone C105008 unknown protein (At5g59500)
mRNA, complete cds
Length = 1222
Score = 40.1 bits (20), Expect = 0.37
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 424 tattgtaacttcagtcttca 443
||||||||||||||||||||
Sbjct: 552 tattgtaacttcagtcttca 571
>gb|AY087834.1| Arabidopsis thaliana clone 38797 mRNA, complete sequence
Length = 1392
Score = 40.1 bits (20), Expect = 0.37
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 424 tattgtaacttcagtcttca 443
||||||||||||||||||||
Sbjct: 647 tattgtaacttcagtcttca 666
>emb|BX830735.1|CNS09YMJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS19ZA09 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1347
Score = 40.1 bits (20), Expect = 0.37
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 424 tattgtaacttcagtcttca 443
||||||||||||||||||||
Sbjct: 625 tattgtaacttcagtcttca 644
>emb|BX831484.1|CNS09ZJ0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS9ZD06 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1326
Score = 40.1 bits (20), Expect = 0.37
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 424 tattgtaacttcagtcttca 443
||||||||||||||||||||
Sbjct: 630 tattgtaacttcagtcttca 649
>dbj|AB025604.1| Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15
Length = 75125
Score = 40.1 bits (20), Expect = 0.37
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 424 tattgtaacttcagtcttca 443
||||||||||||||||||||
Sbjct: 50044 tattgtaacttcagtcttca 50063
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 40.1 bits (20), Expect = 0.37
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 424 tattgtaacttcagtcttca 443
||||||||||||||||||||
Sbjct: 21331888 tattgtaacttcagtcttca 21331907
>ref|NM_125341.2| Arabidopsis thaliana unknown protein AT5G59500 mRNA, complete cds
Length = 1453
Score = 40.1 bits (20), Expect = 0.37
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 424 tattgtaacttcagtcttca 443
||||||||||||||||||||
Sbjct: 647 tattgtaacttcagtcttca 666
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 40.1 bits (20), Expect = 0.37
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 424 tattgtaacttcagtcttca 443
||||||||||||||||||||
Sbjct: 24003801 tattgtaacttcagtcttca 24003820
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 228,974
Number of Sequences: 1013581
Number of extensions: 228974
Number of successful extensions: 16799
Number of sequences better than 0.5: 11
Number of HSP's better than 0.5 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16642
Number of HSP's gapped (non-prelim): 157
length of query: 529
length of database: 908,940,872
effective HSP length: 20
effective length of query: 509
effective length of database: 888,669,252
effective search space: 452332649268
effective search space used: 452332649268
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)