BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2750927.2.1
(1331 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY727601.1| Arabidopsis thaliana ecotype Ita-0 SEPALLATA... 68 4e-009
gb|AY727604.1| Arabidopsis thaliana ecotype Lu-1 SEPALLATA2... 68 4e-009
gb|AY727610.1| Arabidopsis thaliana ecotype PHW-33 SEPALLAT... 68 4e-009
gb|AY727614.1| Arabidopsis thaliana ecotype Cha-0 SEPALLATA... 68 4e-009
gb|AY727618.1| Arabidopsis thaliana ecotype Ko-2 SEPALLATA2... 68 4e-009
gb|BZ663057.1|BZ663057 SALK_026551.47.05.x Arabidopsis thal... 64 7e-008
gb|CW843825.1|CW843825 GT10086.Ds5.02.18.2003.jw81.365 Arab... 64 7e-008
gb|BE038223.1|BE038223 AA10E11 AA Arabidopsis thaliana cDNA... 64 7e-008
gb|DR750275.1|DR750275 65-L020098-065-001-A09-SeLA MPIZ-ADI... 64 7e-008
gb|DR750276.1|DR750276 65-L020099-065-001-A09-SeLB MPIZ-ADI... 64 7e-008
gb|DR751531.1|DR751531 01-L020098-065-001-A01-SeLA MPIZ-ADI... 64 7e-008
gb|DR751532.1|DR751532 01-L020099-065-001-A01-SeLB MPIZ-ADI... 64 7e-008
gb|M55554.1|ATHAGL6A Arabidopsis thaliana transcription fac... 64 7e-008
gb|AF211171.1|AF211171 Arabidopsis thaliana short vegetativ... 64 7e-008
emb|AX052687.1| Sequence 1 from Patent WO0070053 64 7e-008
emb|AX052689.1| Sequence 3 from Patent WO0070053 64 7e-008
emb|AX052691.1| Sequence 5 from Patent WO0070053 64 7e-008
emb|AX052692.1| Sequence 6 from Patent WO0070053 64 7e-008
emb|AX052693.1| Sequence 7 from Patent WO0070053 64 7e-008
emb|AX506507.1| Sequence 1202 from Patent WO0216655 64 7e-008
gb|AC003680.3| Arabidopsis thaliana chromosome 2 BAC F17K2 ... 64 7e-008
gb|AC006592.6| Arabidopsis thaliana chromosome 2 clone F14M... 64 7e-008
emb|BX842431.1|CNS0A8GM Arabidopsis thaliana Full-length cD... 64 7e-008
emb|BX842440.1|CNS0A8OH Arabidopsis thaliana Full-length cD... 64 7e-008
emb|BX842447.1|CNS0A8UX Arabidopsis thaliana Full-length cD... 64 7e-008
emb|BX842456.1|CNS0A915 Arabidopsis thaliana Full-length cD... 64 7e-008
ref|NM_130127.1| Arabidopsis thaliana AGL6; DNA binding / t... 64 7e-008
ref|NM_127820.2| Arabidopsis thaliana SVP (SHORT VEGETATIVE... 64 7e-008
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 64 7e-008
gb|BP821241.1|BP821241 BP821241 RAFL19 Arabidopsis thaliana... 60 1e-006
gb|DR750677.1|DR750677 44-L022242-065-008-D06-SeLA MPIZ-ADI... 60 1e-006
gb|M55552.1|ATHAGL4A Arabidopsis thaliana transcription fac... 60 1e-006
gb|BT004054.1| Arabidopsis thaliana clone RAFL15-21-I11 (R2... 60 1e-006
gb|AC009755.7|ATAC009755 Arabidopsis thaliana chromosome II... 60 1e-006
emb|BX823794.1|CNS0A4WO Arabidopsis thaliana Full-length cD... 60 1e-006
gb|AY727599.1| Arabidopsis thaliana ecotype Co-1 SEPALLATA2... 60 1e-006
gb|AY727600.1| Arabidopsis thaliana ecotype Es-0 SEPALLATA2... 60 1e-006
gb|AY727602.1| Arabidopsis thaliana ecotype Kas-1 SEPALLATA... 60 1e-006
gb|AY727603.1| Arabidopsis thaliana ecotype Li-3 SEPALLATA2... 60 1e-006
gb|AY727605.1| Arabidopsis thaliana ecotype Mt-0 SEPALLATA2... 60 1e-006
gb|AY727606.1| Arabidopsis thaliana ecotype PLA-0 SEPALLATA... 60 1e-006
gb|AY727607.1| Arabidopsis thaliana ecotype Pog-0 SEPALLATA... 60 1e-006
gb|AY727608.1| Arabidopsis thaliana ecotype Tsu-1 SEPALLATA... 60 1e-006
gb|AY727609.1| Arabidopsis thaliana ecotype PHW-1 SEPALLATA... 60 1e-006
gb|AY727611.1| Arabidopsis thaliana ecotype Kondara SEPALLA... 60 1e-006
gb|AY727612.1| Arabidopsis thaliana ecotype An-2 SEPALLATA2... 60 1e-006
gb|AY727613.1| Arabidopsis thaliana ecotype Br-0 SEPALLATA2... 60 1e-006
gb|AY727615.1| Arabidopsis thaliana ecotype Di-0 SEPALLATA2... 60 1e-006
gb|AY727616.1| Arabidopsis thaliana ecotype Est-1 SEPALLATA... 60 1e-006
gb|AY727617.1| Arabidopsis thaliana ecotype Kl-5 SEPALLATA2... 60 1e-006
gb|AY727619.1| Arabidopsis thaliana ecotype Lip-0 SEPALLATA... 60 1e-006
gb|AY727620.1| Arabidopsis thaliana ecotype 9481B SEPALLATA... 60 1e-006
gb|BT020478.1| Arabidopsis thaliana At3g02310 gene, complet... 60 1e-006
ref|NM_111098.3| Arabidopsis thaliana SEP2 (SEPALLATA2); DN... 60 1e-006
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 60 1e-006
gb|DR750509.1|DR750509 52-L022242-065-008-D07-SeLA MPIZ-ADI... 58 4e-006
gb|DR750510.1|DR750510 52-L022243-065-008-D07-SeLB MPIZ-ADI... 58 4e-006
gb|U20183.1|ATU20183 Arabidopsis thaliana MADS-box protein ... 58 4e-006
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 58 4e-006
emb|AL137898.1|ATT20K12 Arabidopsis thaliana DNA chromosome... 58 4e-006
ref|NM_115976.1| Arabidopsis thaliana AGL13 (AGAMOUS-LIKE 1... 58 4e-006
gb|DR751530.1|DR751530 01-L021260-065-001-A01S-SeLA MPIZ-AD... 56 2e-005
dbj|AK175241.1| Arabidopsis thaliana mRNA for short vegegat... 56 2e-005
gb|BZ594199.1|BZ594199 SALK_083060.47.45.x Arabidopsis thal... 48 0.004
gb|BZ594200.1|BZ594200 SALK_083061.45.50.x Arabidopsis thal... 48 0.004
gb|AI993585.1|AI993585 701496687 A. thaliana, Ohio State cl... 48 0.004
gb|BE524598.1|BE524598 M51H6STM Arabidopsis developing seed... 48 0.004
gb|BG459170.1|BG459170 M64G03STM Arabidopsis developing see... 48 0.004
gb|BP856195.1|BP856195 BP856195 RAFL21 Arabidopsis thaliana... 48 0.004
gb|BP868458.1|BP868458 BP868458 RAFL21 Arabidopsis thaliana... 48 0.004
gb|DR750758.1|DR750758 41-L020098-065-001-A06-SeLA MPIZ-ADI... 48 0.004
gb|DR750759.1|DR750759 41-L020099-065-001-A06-SeLB MPIZ-ADI... 48 0.004
gb|AF312663.1|AF312663 Arabidopsis thaliana MADS-box protei... 48 0.004
gb|AY087639.1| Arabidopsis thaliana clone 37288 mRNA, compl... 48 0.004
emb|BX825810.1|CNS0A537 Arabidopsis thaliana Full-length cD... 48 0.004
emb|AL137080.2|ATF28O9 Arabidopsis thaliana DNA chromosome ... 48 0.004
dbj|AK220679.1| Arabidopsis thaliana mRNA for MADS transcri... 48 0.004
dbj|AK222220.1| Arabidopsis thaliana mRNA for MADS transcri... 48 0.004
ref|NM_115599.2| Arabidopsis thaliana AGL18; transcription ... 48 0.004
ref|NM_202721.1| Arabidopsis thaliana AGL18; transcription ... 48 0.004
emb|BX948742.1| Arabidopsis thaliana T-DNA flanking sequenc... 44 0.062
gb|CW796678.1|CW796678 WiscDsLox444D4 Arabidopsis thaliana ... 44 0.062
gb|AU239481.1|AU239481 AU239481 RAFL19 Arabidopsis thaliana... 44 0.062
gb|CF773945.1|CF773945 AG_FSL_25A05 Arabidopsis ag-1 35S:AG... 44 0.062
gb|CK121558.1|CK121558 202j15.p1 AtM1 Arabidopsis thaliana ... 44 0.062
gb|DR750029.1|DR750029 78-L022529-065-010-F10-SeLA MPIZ-ADI... 44 0.062
gb|DR750030.1|DR750030 78-L022530-065-010-F10-SeLB MPIZ-ADI... 44 0.062
gb|DR750691.1|DR750691 41-L022242-065-008-A06-SeLA MPIZ-ADI... 44 0.062
gb|DR750692.1|DR750692 41-L022243-065-008-A06-SeLB MPIZ-ADI... 44 0.062
gb|M55551.1|ATHAGL2A Arabidopsis thaliana transcription fac... 44 0.062
emb|AX380953.1| Sequence 7 from Patent WO0210415 44 0.062
gb|BT006224.1| Arabidopsis thaliana At5g15800 gene, complet... 44 0.062
emb|BX830774.1|CNS0A0QO Arabidopsis thaliana Full-length cD... 44 0.062
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 44 0.062
dbj|AK118608.1| Arabidopsis thaliana At5g15800 mRNA for put... 44 0.062
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 44 0.062
gb|AY727576.1| Arabidopsis thaliana ecotype Est-1 SEPALLATA... 44 0.062
gb|AY727577.1| Arabidopsis thaliana ecotype Ler-0 SEPALLATA... 44 0.062
gb|AY727578.1| Arabidopsis thaliana ecotype Cha-0 SEPALLATA... 44 0.062
gb|AY727579.1| Arabidopsis thaliana ecotype Lu-1 SEPALLATA1... 44 0.062
gb|AY727580.1| Arabidopsis thaliana ecotype PHW-33 SEPALLAT... 44 0.062
gb|AY727581.1| Arabidopsis thaliana ecotype PLA-0 SEPALLATA... 44 0.062
gb|AY727582.1| Arabidopsis thaliana ecotype Ko-2 SEPALLATA1... 44 0.062
gb|AY727583.1| Arabidopsis thaliana ecotype Kas-1 SEPALLATA... 44 0.062
gb|AY727584.1| Arabidopsis thaliana ecotype Kondara SEPALLA... 44 0.062
gb|AY727585.1| Arabidopsis thaliana ecotype Tsu-1 SEPALLATA... 44 0.062
gb|AY727586.1| Arabidopsis thaliana ecotype Wassilewskija S... 44 0.062
gb|AY727587.1| Arabidopsis thaliana ecotype Es-0 SEPALLATA1... 44 0.062
gb|AY727588.1| Arabidopsis thaliana ecotype Li-3 SEPALLATA1... 44 0.062
gb|AY727589.1| Arabidopsis thaliana ecotype Mt-0 SEPALLATA1... 44 0.062
gb|AY727590.1| Arabidopsis thaliana ecotype Br-0 SEPALLATA1... 44 0.062
gb|AY727591.1| Arabidopsis thaliana ecotype Kl-5 SEPALLATA1... 44 0.062
gb|AY727592.1| Arabidopsis thaliana ecotype Lip-0 SEPALLATA... 44 0.062
gb|AY727593.1| Arabidopsis thaliana ecotype Ita-0 SEPALLATA... 44 0.062
gb|AY727594.1| Arabidopsis thaliana ecotype Co-1 SEPALLATA1... 44 0.062
gb|AY727595.1| Arabidopsis thaliana ecotype Pog-0 SEPALLATA... 44 0.062
gb|AY727596.1| Arabidopsis thaliana ecotype PHW-1 SEPALLATA... 44 0.062
gb|AY727597.1| Arabidopsis thaliana ecotype Di-0 SEPALLATA1... 44 0.062
emb|AL021711.2|ATF13C5 Arabidopsis thaliana DNA chromosome ... 44 0.062
emb|AL161549.2|ATCHRIV49 Arabidopsis thaliana DNA chromosom... 44 0.062
emb|AL391144.1|ATF14F8 Arabidopsis thaliana DNA chromosome ... 44 0.062
emb|X53579.1|ATAGAMSG A.thaliana agamous (AG) gene 44 0.062
ref|NM_118013.2| Arabidopsis thaliana AG (AGAMOUS); transcr... 44 0.062
ref|NM_121585.2| Arabidopsis thaliana SEP1 (SEPALLATA1); DN... 44 0.062
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 44 0.062
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 44 0.062
gb|H35946.1|H35946 14468 Lambda-PRL2 Arabidopsis thaliana c... 42 0.24
gb|H36958.1|H36958 15087 Lambda-PRL2 Arabidopsis thaliana c... 42 0.24
gb|AI995037.1|AI995037 701501560 A. thaliana, Ohio State cl... 42 0.24
gb|AV828127.1|AV828127 AV828127 RAFL9 Arabidopsis thaliana ... 42 0.24
gb|BU636533.1|BU636533 006H08 Infected Arabidopsis Leaf Ara... 42 0.24
gb|BX837240.1|BX837240 BX837240 Arabidopsis thaliana Adult ... 42 0.24
gb|AV441647.1|AV441647 AV441647 Arabidopsis thaliana above-... 42 0.24
gb|DR750280.1|DR750280 63-L022242-065-008-G08-SeLA MPIZ-ADI... 42 0.24
gb|DR750443.1|DR750443 57-L020098-065-001-A08-SeLA MPIZ-ADI... 42 0.24
gb|DR750444.1|DR750444 57-L020099-065-001-A08-SeLB MPIZ-ADI... 42 0.24
gb|DR750712.1|DR750712 42-L022242-065-008-B06-SeLA MPIZ-ADI... 42 0.24
gb|DR750732.1|DR750732 43-L022242-065-008-C06-SeLA MPIZ-ADI... 42 0.24
gb|DR750905.1|DR750905 33-L020098-065-001-A05-SeLA MPIZ-ADI... 42 0.24
gb|DR750906.1|DR750906 33-L020099-065-001-A05-SeLB MPIZ-ADI... 42 0.24
gb|U81369.1|ATU81369 Arabidopsis thaliana MADS box protein ... 42 0.24
gb|U20186.1|ATU20186 Arabidopsis thaliana MADS-box protein ... 42 0.24
gb|AY063894.1| Arabidopsis thaliana putative MADS-box prote... 42 0.24
gb|AY096386.1| Arabidopsis thaliana putative MADS-box prote... 42 0.24
emb|AX507178.1| Sequence 1873 from Patent WO0216655 42 0.24
gb|AF336979.1| Arabidopsis thaliana MADS-box protein AGL21 ... 42 0.24
gb|AY141229.1| Arabidopsis thaliana MADS-box protein AGL3-I... 42 0.24
gb|AC006340.5| Arabidopsis thaliana chromosome 2 clone T9I2... 42 0.24
gb|AC006836.7| Arabidopsis thaliana chromosome 2 clone F19B... 42 0.24
emb|BX824988.1|CNS0A5QY Arabidopsis thaliana Full-length cD... 42 0.24
emb|BX819695.1|CNS0A8HF Arabidopsis thaliana Full-length cD... 42 0.24
emb|AL035538.1|ATF20D10 Arabidopsis thaliana DNA chromosome... 42 0.24
emb|AL161592.2|ATCHRIV88 Arabidopsis thaliana DNA chromosom... 42 0.24
ref|NM_126418.1| Arabidopsis thaliana AGL3 (AGAMOUS-LIKE 3)... 42 0.24
ref|NM_127828.1| Arabidopsis thaliana AGL17 (AGAMOUS-LIKE 1... 42 0.24
ref|NM_119955.1| Arabidopsis thaliana AGL21; transcription ... 42 0.24
ref|NM_179599.1| Arabidopsis thaliana AGL3 (AGAMOUS-LIKE 3)... 42 0.24
ref|NM_201682.1| Arabidopsis thaliana AGL3 (AGAMOUS-LIKE 3)... 42 0.24
>gb|AY727601.1| Arabidopsis thaliana ecotype Ita-0 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3294
Score = 67.9 bits (34), Expect = 4e-009
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || |||||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1316 ctctgcgatgctgaggtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1375
Query: 383 ggcagc 388
|||||
Sbjct: 1376 tgcagc 1381
>gb|AY727604.1| Arabidopsis thaliana ecotype Lu-1 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3329
Score = 67.9 bits (34), Expect = 4e-009
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || |||||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1351 ctctgcgatgctgaggtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1410
Query: 383 ggcagc 388
|||||
Sbjct: 1411 tgcagc 1416
>gb|AY727610.1| Arabidopsis thaliana ecotype PHW-33 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3346
Score = 67.9 bits (34), Expect = 4e-009
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || |||||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1348 ctctgcgatgctgaggtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1407
Query: 383 ggcagc 388
|||||
Sbjct: 1408 tgcagc 1413
>gb|AY727614.1| Arabidopsis thaliana ecotype Cha-0 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3329
Score = 67.9 bits (34), Expect = 4e-009
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || |||||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1351 ctctgcgatgctgaggtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1410
Query: 383 ggcagc 388
|||||
Sbjct: 1411 tgcagc 1416
>gb|AY727618.1| Arabidopsis thaliana ecotype Ko-2 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3346
Score = 67.9 bits (34), Expect = 4e-009
Identities = 58/66 (87%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || |||||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1348 ctctgcgatgctgaggtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1407
Query: 383 ggcagc 388
|||||
Sbjct: 1408 tgcagc 1413
>gb|BZ663057.1|BZ663057 SALK_026551.47.05.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_026551.47.05.x,
DNA sequence
Length = 426
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 114 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 157
>gb|CW843825.1|CW843825 GT10086.Ds5.02.18.2003.jw81.365 Arabidopsis thaliana Landsberg Ds
insertion lines Arabidopsis thaliana genomic clone
GT10086, DNA sequence
Length = 365
Score = 63.9 bits (32), Expect = 7e-008
Identities = 50/56 (89%)
Strand = Plus / Minus
Query: 326 tgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagtt 381
||||| ||||| || || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 278 tgcgatgccgaagttgctctcatcatcttctcaagccgtggcaagctctacgagtt 223
>gb|BE038223.1|BE038223 AA10E11 AA Arabidopsis thaliana cDNA 5' similar to mads-box
protein, mRNA sequence
Length = 704
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 241 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 284
>gb|DR750275.1|DR750275 65-L020098-065-001-A09-SeLA MPIZ-ADIS-065d Arabidopsis thaliana
cDNA clone 001-A09, mRNA sequence
Length = 953
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 194 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 237
>gb|DR750276.1|DR750276 65-L020099-065-001-A09-SeLB MPIZ-ADIS-065d Arabidopsis thaliana
cDNA clone 001-A09, mRNA sequence
Length = 920
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 648 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 605
>gb|DR751531.1|DR751531 01-L020098-065-001-A01-SeLA MPIZ-ADIS-065d Arabidopsis thaliana
cDNA clone 001-A01, mRNA sequence
Length = 964
Score = 63.9 bits (32), Expect = 7e-008
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 326 tgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagtt 381
||||| ||||| || || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 206 tgcgatgccgaagttgctctcatcatcttctcaagccgtggcaagctctacgagtt 261
>gb|DR751532.1|DR751532 01-L020099-065-001-A01-SeLB MPIZ-ADIS-065d Arabidopsis thaliana
cDNA clone 001-A01, mRNA sequence
Length = 748
Score = 63.9 bits (32), Expect = 7e-008
Identities = 50/56 (89%)
Strand = Plus / Minus
Query: 326 tgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagtt 381
||||| ||||| || || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 593 tgcgatgccgaagttgctctcatcatcttctcaagccgtggcaagctctacgagtt 538
>gb|M55554.1|ATHAGL6A Arabidopsis thaliana transcription factor (AGL6) mRNA, complete cds
Length = 1093
Score = 63.9 bits (32), Expect = 7e-008
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 326 tgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagtt 381
||||| ||||| || || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 218 tgcgatgccgaagttgctctcatcatcttctcaagccgtggcaagctctacgagtt 273
>gb|AF211171.1|AF211171 Arabidopsis thaliana short vegetative phase protein (SVP) mRNA,
complete cds
Length = 1518
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 632 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 675
>emb|AX052687.1| Sequence 1 from Patent WO0070053
Length = 1771
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 514 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 557
>emb|AX052689.1| Sequence 3 from Patent WO0070053
Length = 1368
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 521 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 564
>emb|AX052691.1| Sequence 5 from Patent WO0070053
Length = 2134
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 103 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 146
>emb|AX052692.1| Sequence 6 from Patent WO0070053
Length = 3184
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 103 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 146
>emb|AX052693.1| Sequence 7 from Patent WO0070053
Length = 10617
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 4862 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 4905
>emb|AX506507.1| Sequence 1202 from Patent WO0216655
Length = 633
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 103 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 146
>gb|AC003680.3| Arabidopsis thaliana chromosome 2 BAC F17K2 genomic sequence, complete
sequence
Length = 91854
Score = 63.9 bits (32), Expect = 7e-008
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 326 tgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagtt 381
||||| ||||| || || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 57911 tgcgatgccgaagttgctctcatcatcttctcaagccgtggcaagctctacgagtt 57966
>gb|AC006592.6| Arabidopsis thaliana chromosome 2 clone F14M13 map mi238, complete
sequence
Length = 106949
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 13767 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 13724
>emb|BX842431.1|CNS0A8GM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS10ZE07 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1390
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 616 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 659
>emb|BX842440.1|CNS0A8OH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH56ZH06 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1341
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 505 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 548
>emb|BX842447.1|CNS0A8UX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB15ZD07 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1460
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 264 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 307
>emb|BX842456.1|CNS0A915 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH84ZA03 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1363
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 532 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 575
>ref|NM_130127.1| Arabidopsis thaliana AGL6; DNA binding / transcription factor
AT2G45650 (AGL6) mRNA, complete cds
Length = 1093
Score = 63.9 bits (32), Expect = 7e-008
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 326 tgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagtt 381
||||| ||||| || || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 218 tgcgatgccgaagttgctctcatcatcttctcaagccgtggcaagctctacgagtt 273
>ref|NM_127820.2| Arabidopsis thaliana SVP (SHORT VEGETATIVE PHASE); transcription
factor AT2G22540 (SVP) mRNA, complete cds
Length = 1546
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 643 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 686
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 63.9 bits (32), Expect = 7e-008
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 326 tgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagtt 381
||||| ||||| || || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 18811641 tgcgatgccgaagttgctctcatcatcttctcaagccgtggcaagctctacgagtt 18811696
Score = 63.9 bits (32), Expect = 7e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 314 ctctccgtgctctgcgacgccgaggtcgcgctcatcatcttctc 357
|||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 9587599 ctctccgttctctgcgacgccgatgtcgctctcatcatcttctc 9587642
Score = 42.1 bits (21), Expect = 0.24
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctcca 359
|||||||||||||||||| |||||||| |||||||
Sbjct: 9625563 ctctgcgacgccgaggtctgtctcatcattttctcca 9625599
Score = 42.1 bits (21), Expect = 0.24
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 226 agttgagctcaagcggatcgagaacaagatcaa 258
||||||||| ||| |||| ||||||||||||||
Sbjct: 1129633 agttgagctgaagaggatagagaacaagatcaa 1129665
>gb|BP821241.1|BP821241 BP821241 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-57-F09 5',
mRNA sequence
Length = 396
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 120 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 179
Query: 383 ggcagc 388
|||||
Sbjct: 180 tgcagc 185
>gb|DR750677.1|DR750677 44-L022242-065-008-D06-SeLA MPIZ-ADIS-065d Arabidopsis thaliana
cDNA clone 008-D06, mRNA sequence
Length = 661
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 214 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 273
Query: 383 ggcagc 388
|||||
Sbjct: 274 tgcagc 279
>gb|M55552.1|ATHAGL4A Arabidopsis thaliana transcription factor (AGL4) mRNA, complete cds
Length = 1348
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 450 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 509
Query: 383 ggcagc 388
|||||
Sbjct: 510 tgcagc 515
>gb|BT004054.1| Arabidopsis thaliana clone RAFL15-21-I11 (R20467) putative floral
homeotic protein AGL4 (At3g02310) mRNA, complete cds
Length = 1325
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 462 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 521
Query: 383 ggcagc 388
|||||
Sbjct: 522 tgcagc 527
>gb|AC009755.7|ATAC009755 Arabidopsis thaliana chromosome III BAC F14P3 genomic sequence,
complete sequence
Length = 94369
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 8305 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 8364
Query: 383 ggcagc 388
|||||
Sbjct: 8365 tgcagc 8370
>emb|BX823794.1|CNS0A4WO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS76ZD01 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1312
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 396 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 455
Query: 383 ggcagc 388
|||||
Sbjct: 456 tgcagc 461
>gb|AY727599.1| Arabidopsis thaliana ecotype Co-1 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3393
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1351 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1410
Query: 383 ggcagc 388
|||||
Sbjct: 1411 tgcagc 1416
>gb|AY727600.1| Arabidopsis thaliana ecotype Es-0 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3355
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1339 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1398
Query: 383 ggcagc 388
|||||
Sbjct: 1399 tgcagc 1404
>gb|AY727602.1| Arabidopsis thaliana ecotype Kas-1 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3367
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1351 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1410
Query: 383 ggcagc 388
|||||
Sbjct: 1411 tgcagc 1416
>gb|AY727603.1| Arabidopsis thaliana ecotype Li-3 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3381
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1351 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1410
Query: 383 ggcagc 388
|||||
Sbjct: 1411 tgcagc 1416
>gb|AY727605.1| Arabidopsis thaliana ecotype Mt-0 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3355
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1351 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1410
Query: 383 ggcagc 388
|||||
Sbjct: 1411 tgcagc 1416
>gb|AY727606.1| Arabidopsis thaliana ecotype PLA-0 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3355
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1347 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1406
Query: 383 ggcagc 388
|||||
Sbjct: 1407 tgcagc 1412
>gb|AY727607.1| Arabidopsis thaliana ecotype Pog-0 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3346
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1332 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1391
Query: 383 ggcagc 388
|||||
Sbjct: 1392 tgcagc 1397
>gb|AY727608.1| Arabidopsis thaliana ecotype Tsu-1 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3323
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1320 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1379
Query: 383 ggcagc 388
|||||
Sbjct: 1380 tgcagc 1385
>gb|AY727609.1| Arabidopsis thaliana ecotype PHW-1 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3371
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1351 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1410
Query: 383 ggcagc 388
|||||
Sbjct: 1411 tgcagc 1416
>gb|AY727611.1| Arabidopsis thaliana ecotype Kondara SEPALLATA2 (SEP2) gene, complete
cds
Length = 3369
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1351 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1410
Query: 383 ggcagc 388
|||||
Sbjct: 1411 tgcagc 1416
>gb|AY727612.1| Arabidopsis thaliana ecotype An-2 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3357
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1351 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1410
Query: 383 ggcagc 388
|||||
Sbjct: 1411 tgcagc 1416
>gb|AY727613.1| Arabidopsis thaliana ecotype Br-0 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3356
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1347 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1406
Query: 383 ggcagc 388
|||||
Sbjct: 1407 tgcagc 1412
>gb|AY727615.1| Arabidopsis thaliana ecotype Di-0 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3363
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1339 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1398
Query: 383 ggcagc 388
|||||
Sbjct: 1399 tgcagc 1404
>gb|AY727616.1| Arabidopsis thaliana ecotype Est-1 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3354
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1347 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1406
Query: 383 ggcagc 388
|||||
Sbjct: 1407 tgcagc 1412
>gb|AY727617.1| Arabidopsis thaliana ecotype Kl-5 SEPALLATA2 (SEP2) gene, complete
cds
Length = 3365
Score = 60.0 bits (30), Expect = 1e-006
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 323 ctctgcgacgccgaggtcgcgctcatcatcttctccagccgcggcaagctctacgagttc 382
|||||||| || || ||| | |||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 1347 ctctgcgatgctgaagtctctctcatcgtcttctccaaccgtggcaagctctacgagttc 1406
Query: 383 ggcagc 388
|||||
Sbjct: 1407 tgcagc 1412
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 607,934
Number of Sequences: 1013581
Number of extensions: 607934
Number of successful extensions: 44579
Number of sequences better than 0.5: 158
Number of HSP's better than 0.5 without gapping: 163
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41553
Number of HSP's gapped (non-prelim): 3026
length of query: 1331
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1311
effective length of database: 888,669,252
effective search space: 1165045389372
effective search space used: 1165045389372
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)