BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2750436.2.1
(656 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AU228609.1|AU228609 AU228609 RAFL16 Arabidopsis thaliana... 50 5e-004
gb|BP596445.1|BP596445 BP596445 RAFL15 Arabidopsis thaliana... 50 5e-004
gb|BP596923.1|BP596923 BP596923 RAFL15 Arabidopsis thaliana... 50 5e-004
gb|AY087693.1| Arabidopsis thaliana clone 37727 mRNA, compl... 50 5e-004
emb|BX827981.1|CNS0A32E Arabidopsis thaliana Full-length cD... 50 5e-004
emb|BX828387.1|CNS0A347 Arabidopsis thaliana Full-length cD... 50 5e-004
emb|BX826434.1|CNS0A37T Arabidopsis thaliana Full-length cD... 50 5e-004
emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, shor... 50 5e-004
emb|AL161496.2|ATCHRIV8 Arabidopsis thaliana DNA chromosome... 50 5e-004
gb|AC005275.1| Arabidopsis thaliana BAC F4C21 from chromoso... 50 5e-004
ref|NM_116571.1| Arabidopsis thaliana SYP123; t-SNARE AT4G0... 50 5e-004
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 50 5e-004
>gb|AU228609.1|AU228609 AU228609 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-33-P16 3',
mRNA sequence
Length = 453
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 340 gccatgtcgaggaacacttggtgcagctc 368
>gb|BP596445.1|BP596445 BP596445 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-34-L18 3',
mRNA sequence
Length = 446
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 372 gccatgtcgaggaacacttggtgcagctc 400
>gb|BP596923.1|BP596923 BP596923 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-37-F14 3',
mRNA sequence
Length = 455
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 372 gccatgtcgaggaacacttggtgcagctc 400
>gb|AY087693.1| Arabidopsis thaliana clone 37727 mRNA, complete sequence
Length = 1247
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 890 gccatgtcgaggaacacttggtgcagctc 862
>emb|BX827981.1|CNS0A32E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH41ZC07 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1042
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 758 gccatgtcgaggaacacttggtgcagctc 730
>emb|BX828387.1|CNS0A347 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH83ZB01 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 762
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 461 gccatgtcgaggaacacttggtgcagctc 433
>emb|BX826434.1|CNS0A37T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB26ZE05 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1239
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 1029 gccatgtcgaggaacacttggtgcagctc 1001
>emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, short arm
Length = 3052119
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 1466201 gccatgtcgaggaacacttggtgcagctc 1466173
>emb|AL161496.2|ATCHRIV8 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 8
Length = 195429
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 118534 gccatgtcgaggaacacttggtgcagctc 118506
>gb|AC005275.1| Arabidopsis thaliana BAC F4C21 from chromosome IV, top arm, near 17 cM,
complete sequence
Length = 136335
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 100162 gccatgtcgaggaacacttggtgcagctc 100134
>ref|NM_116571.1| Arabidopsis thaliana SYP123; t-SNARE AT4G03330 (SYP123) mRNA,
complete cds
Length = 1247
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 890 gccatgtcgaggaacacttggtgcagctc 862
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 484 gccatgtcgaggaacacttggtggagctc 512
||||||||||||||||||||||| |||||
Sbjct: 1467387 gccatgtcgaggaacacttggtgcagctc 1467359
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 228,633
Number of Sequences: 1013581
Number of extensions: 228633
Number of successful extensions: 17698
Number of sequences better than 0.5: 12
Number of HSP's better than 0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17554
Number of HSP's gapped (non-prelim): 144
length of query: 656
length of database: 908,940,872
effective HSP length: 20
effective length of query: 636
effective length of database: 888,669,252
effective search space: 565193644272
effective search space used: 565193644272
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)