BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2623104.2.4
(1628 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CC459017.1|CC459017 SALK_123620.49.05.x Arabidopsis thal... 42 0.30
emb|X97383.1|ATDRAN2 A.thaliana atran2 gene 42 0.30
gb|AF296836.1|F28I16 Arabidopsis thaliana BAC F28I16 42 0.30
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 42 0.30
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 42 0.30
>gb|CC459017.1|CC459017 SALK_123620.49.05.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_123620.49.05.x,
DNA sequence
Length = 413
Score = 42.1 bits (21), Expect = 0.30
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1525 attatttattttgtcaaaact 1545
|||||||||||||||||||||
Sbjct: 261 attatttattttgtcaaaact 241
>emb|X97383.1|ATDRAN2 A.thaliana atran2 gene
Length = 3544
Score = 42.1 bits (21), Expect = 0.30
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1525 attatttattttgtcaaaact 1545
|||||||||||||||||||||
Sbjct: 646 attatttattttgtcaaaact 666
>gb|AF296836.1|F28I16 Arabidopsis thaliana BAC F28I16
Length = 84334
Score = 42.1 bits (21), Expect = 0.30
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1525 attatttattttgtcaaaact 1545
|||||||||||||||||||||
Sbjct: 51297 attatttattttgtcaaaact 51317
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 42.1 bits (21), Expect = 0.30
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1525 attatttattttgtcaaaact 1545
|||||||||||||||||||||
Sbjct: 6476892 attatttattttgtcaaaact 6476912
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 42.1 bits (21), Expect = 0.30
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1525 attatttattttgtcaaaact 1545
|||||||||||||||||||||
Sbjct: 6762568 attatttattttgtcaaaact 6762588
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 676,723
Number of Sequences: 1013581
Number of extensions: 676723
Number of successful extensions: 51853
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51233
Number of HSP's gapped (non-prelim): 620
length of query: 1628
length of database: 908,940,872
effective HSP length: 21
effective length of query: 1607
effective length of database: 887,655,671
effective search space: 1426462663297
effective search space used: 1426462663297
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)