BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2594433.2.1
(766 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 68 2e-009
emb|AL133421.1|ATF13G24 Arabidopsis thaliana DNA chromosome... 68 2e-009
emb|AL357612.1|ATT22D6 Arabidopsis thaliana DNA chromosome ... 68 2e-009
ref|NM_120884.1| Arabidopsis thaliana DNA binding / nucleic... 68 2e-009
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 68 2e-009
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 67.9 bits (34), Expect = 2e-009
Identities = 55/62 (88%)
Strand = Plus / Minus
Query: 674 ttcagtcaccttcttgttgcaggtcttgcaagcacggtaccacatgttctggtcaggctt 733
|||||| || |||||||| |||||||||||||||||||||||||| | ||||| |||||
Sbjct: 2393338 ttcagtaactttcttgttacaggtcttgcaagcacggtaccacattgtttggtctggctt 2393279
Query: 734 ga 735
||
Sbjct: 2393278 ga 2393277
>emb|AL133421.1|ATF13G24 Arabidopsis thaliana DNA chromosome 5, BAC clone F13G24 (ESSA project)
Length = 88095
Score = 67.9 bits (34), Expect = 2e-009
Identities = 55/62 (88%)
Strand = Plus / Minus
Query: 674 ttcagtcaccttcttgttgcaggtcttgcaagcacggtaccacatgttctggtcaggctt 733
|||||| || |||||||| |||||||||||||||||||||||||| | ||||| |||||
Sbjct: 81212 ttcagtaactttcttgttacaggtcttgcaagcacggtaccacattgtttggtctggctt 81153
Query: 734 ga 735
||
Sbjct: 81152 ga 81151
>emb|AL357612.1|ATT22D6 Arabidopsis thaliana DNA chromosome 5, BAC clone T22D6 (ESSA
project)
Length = 89988
Score = 67.9 bits (34), Expect = 2e-009
Identities = 55/62 (88%)
Strand = Plus / Minus
Query: 674 ttcagtcaccttcttgttgcaggtcttgcaagcacggtaccacatgttctggtcaggctt 733
|||||| || |||||||| |||||||||||||||||||||||||| | ||||| |||||
Sbjct: 970 ttcagtaactttcttgttacaggtcttgcaagcacggtaccacattgtttggtctggctt 911
Query: 734 ga 735
||
Sbjct: 910 ga 909
>ref|NM_120884.1| Arabidopsis thaliana DNA binding / nucleic acid binding AT5G08020
mRNA, complete cds
Length = 1815
Score = 67.9 bits (34), Expect = 2e-009
Identities = 55/62 (88%)
Strand = Plus / Minus
Query: 674 ttcagtcaccttcttgttgcaggtcttgcaagcacggtaccacatgttctggtcaggctt 733
|||||| || |||||||| |||||||||||||||||||||||||| | ||||| |||||
Sbjct: 1431 ttcagtaactttcttgttacaggtcttgcaagcacggtaccacattgtttggtctggctt 1372
Query: 734 ga 735
||
Sbjct: 1371 ga 1370
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 67.9 bits (34), Expect = 2e-009
Identities = 55/62 (88%)
Strand = Plus / Minus
Query: 674 ttcagtcaccttcttgttgcaggtcttgcaagcacggtaccacatgttctggtcaggctt 733
|||||| || |||||||| |||||||||||||||||||||||||| | ||||| |||||
Sbjct: 2574302 ttcagtaactttcttgttacaggtcttgcaagcacggtaccacattgtttggtctggctt 2574243
Query: 734 ga 735
||
Sbjct: 2574242 ga 2574241
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 305,362
Number of Sequences: 1013581
Number of extensions: 305362
Number of successful extensions: 20373
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20156
Number of HSP's gapped (non-prelim): 217
length of query: 766
length of database: 908,940,872
effective HSP length: 20
effective length of query: 746
effective length of database: 888,669,252
effective search space: 662947261992
effective search space used: 662947261992
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)