BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2550113.2.1
(803 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV784434.1|AV784434 AV784434 RAFL5 Arabidopsis thaliana ... 84 4e-014
gb|AV787483.1|AV787483 AV787483 RAFL6 Arabidopsis thaliana ... 84 4e-014
gb|AV823465.1|AV823465 AV823465 RAFL5 Arabidopsis thaliana ... 84 4e-014
gb|BU635873.1|BU635873 005A09 Infected Arabidopsis Leaf Ara... 84 4e-014
gb|BP783102.1|BP783102 BP783102 RAFL7 Arabidopsis thaliana ... 84 4e-014
gb|BP818534.1|BP818534 BP818534 RAFL19 Arabidopsis thaliana... 84 4e-014
gb|AY045818.1| Arabidopsis thaliana putative 60S ribosomal ... 84 4e-014
gb|AY091359.1| Arabidopsis thaliana putative 60S ribosomal ... 84 4e-014
ref|NM_113811.3| Arabidopsis thaliana structural constituen... 84 4e-014
gb|BP587808.1|BP587808 BP587808 RAFL15 Arabidopsis thaliana... 82 2e-013
emb|BX825772.1|CNS0A6BD Arabidopsis thaliana Full-length cD... 78 3e-012
gb|BP652482.1|BP652482 BP652482 RAFL19 Arabidopsis thaliana... 76 1e-011
emb|BX825773.1|CNS0A6BE Arabidopsis thaliana Full-length cD... 76 1e-011
gb|CB259748.1|CB259748 25-E9623-013-004-A08-T7R MPIZ-ADIS-0... 70 6e-010
gb|BP627689.1|BP627689 BP627689 RAFL17 Arabidopsis thaliana... 70 6e-010
gb|BP866155.1|BP866155 BP866155 RAFL21 Arabidopsis thaliana... 70 6e-010
gb|BP585523.1|BP585523 BP585523 RAFL15 Arabidopsis thaliana... 66 1e-008
gb|BP828332.1|BP828332 BP828332 RAFL19 Arabidopsis thaliana... 66 1e-008
gb|F20073.1|F20073 ATTS6112 AC16H Arabidopsis thaliana cDNA... 62 2e-007
gb|N96599.1|N96599 21274 Lambda-PRL1 Arabidopsis thaliana c... 62 2e-007
gb|AI994094.1|AI994094 701498663 A. thaliana, Ohio State cl... 62 2e-007
gb|AI995012.1|AI995012 701501452 A. thaliana, Ohio State cl... 62 2e-007
gb|BE039060.1|BE039060 AB09B02 AB Arabidopsis thaliana cDNA... 62 2e-007
gb|AV787370.1|AV787370 AV787370 RAFL6 Arabidopsis thaliana ... 62 2e-007
gb|CB262293.1|CB262293 66-E8879-008-014-C18-pBl2 MPIZ-ADIS-... 62 2e-007
gb|CB264494.1|CB264494 58-E014994-035-003-C16-T7R MPIZ-ADIS... 62 2e-007
gb|BX836706.1|BX836706 BX836706 Arabidopsis thaliana Flower... 62 2e-007
gb|AV526629.1|AV526629 AV526629 Arabidopsis thaliana aboveg... 62 2e-007
gb|AV532287.1|AV532287 AV532287 Arabidopsis thaliana flower... 62 2e-007
gb|AV533399.1|AV533399 AV533399 Arabidopsis thaliana flower... 62 2e-007
gb|AV534396.1|AV534396 AV534396 Arabidopsis thaliana flower... 62 2e-007
gb|AV537579.1|AV537579 AV537579 Arabidopsis thaliana roots ... 62 2e-007
gb|BP561283.1|BP561283 BP561283 RAFL6 Arabidopsis thaliana ... 62 2e-007
gb|BP574454.1|BP574454 BP574454 RAFL14 Arabidopsis thaliana... 62 2e-007
gb|BP582226.1|BP582226 BP582226 RAFL14 Arabidopsis thaliana... 62 2e-007
gb|BP583743.1|BP583743 BP583743 RAFL14 Arabidopsis thaliana... 62 2e-007
gb|BP624822.1|BP624822 BP624822 RAFL17 Arabidopsis thaliana... 62 2e-007
gb|BP624999.1|BP624999 BP624999 RAFL17 Arabidopsis thaliana... 62 2e-007
gb|BP792167.1|BP792167 BP792167 RAFL7 Arabidopsis thaliana ... 62 2e-007
gb|BP818794.1|BP818794 BP818794 RAFL19 Arabidopsis thaliana... 62 2e-007
gb|BP833469.1|BP833469 BP833469 RAFL19 Arabidopsis thaliana... 62 2e-007
gb|BP834364.1|BP834364 BP834364 RAFL19 Arabidopsis thaliana... 62 2e-007
gb|BP868072.1|BP868072 BP868072 RAFL21 Arabidopsis thaliana... 62 2e-007
gb|AF324703.1|AF324703 Arabidopsis thaliana T6C23.18 mRNA, ... 62 2e-007
gb|AY052720.1| Arabidopsis thaliana F24J1.23/F24J1.23 mRNA,... 62 2e-007
gb|AF446885.1|AF446885 Arabidopsis thaliana F24J1.23/F24J1.... 62 2e-007
gb|AF327531.1| Arabidopsis thaliana putative 60S ribosomal ... 62 2e-007
gb|AF349526.1| Arabidopsis thaliana putative 60S ribosomal ... 62 2e-007
gb|AY080712.1| Arabidopsis thaliana putative 60s ribosomal ... 62 2e-007
gb|AY117327.1| Arabidopsis thaliana putative 60S ribosomal ... 62 2e-007
emb|AX506058.1| Sequence 753 from Patent WO0216655 62 2e-007
gb|AY085544.1| Arabidopsis thaliana clone 1568 mRNA, comple... 62 2e-007
gb|AY088495.1| Arabidopsis thaliana clone 7182 mRNA, comple... 62 2e-007
emb|BX818608.1|CNS0AAXR Arabidopsis thaliana Full-length cD... 62 2e-007
emb|BX814797.1|CNS0AC1Q Arabidopsis thaliana Full-length cD... 62 2e-007
emb|BX814361.1|CNS0AEHP Arabidopsis thaliana Full-length cD... 62 2e-007
ref|NM_105630.2| Arabidopsis thaliana RPL34 (RIBOSOMAL PROT... 62 2e-007
ref|NM_102452.3| Arabidopsis thaliana structural constituen... 62 2e-007
gb|BP581235.1|BP581235 BP581235 RAFL14 Arabidopsis thaliana... 60 6e-007
gb|BP638564.1|BP638564 BP638564 RAFL19 Arabidopsis thaliana... 60 6e-007
gb|BP799247.1|BP799247 BP799247 RAFL14 Arabidopsis thaliana... 60 6e-007
gb|AV533404.1|AV533404 AV533404 Arabidopsis thaliana flower... 58 2e-006
gb|BP586707.1|BP586707 BP586707 RAFL15 Arabidopsis thaliana... 58 2e-006
gb|BP589285.1|BP589285 BP589285 RAFL15 Arabidopsis thaliana... 58 2e-006
gb|BP867672.1|BP867672 BP867672 RAFL21 Arabidopsis thaliana... 58 2e-006
emb|BX814692.1|CNS0ADOU Arabidopsis thaliana Full-length cD... 58 2e-006
gb|BP635612.1|BP635612 BP635612 RAFL18 Arabidopsis thaliana... 56 1e-005
gb|BP669000.1|BP669000 BP669000 RAFL21 Arabidopsis thaliana... 56 1e-005
gb|BP828373.1|BP828373 BP828373 RAFL19 Arabidopsis thaliana... 56 1e-005
gb|BP565090.1|BP565090 BP565090 RAFL14 Arabidopsis thaliana... 54 4e-005
gb|BP566178.1|BP566178 BP566178 RAFL14 Arabidopsis thaliana... 54 4e-005
gb|BP595507.1|BP595507 BP595507 RAFL15 Arabidopsis thaliana... 54 4e-005
gb|BP633791.1|BP633791 BP633791 RAFL17 Arabidopsis thaliana... 54 4e-005
gb|BP785267.1|BP785267 BP785267 RAFL7 Arabidopsis thaliana ... 54 4e-005
gb|BP797192.1|BP797192 BP797192 RAFL14 Arabidopsis thaliana... 54 4e-005
gb|BP803349.1|BP803349 BP803349 RAFL14 Arabidopsis thaliana... 54 4e-005
gb|BP839116.1|BP839116 BP839116 RAFL19 Arabidopsis thaliana... 54 4e-005
gb|BP842426.1|BP842426 BP842426 RAFL21 Arabidopsis thaliana... 54 4e-005
gb|BP843089.1|BP843089 BP843089 RAFL21 Arabidopsis thaliana... 54 4e-005
gb|BP863149.1|BP863149 BP863149 RAFL21 Arabidopsis thaliana... 54 4e-005
emb|AL951922.1| Arabidopsis thaliana T-DNA flanking sequenc... 52 2e-004
emb|AL951923.1| Arabidopsis thaliana T-DNA flanking sequenc... 52 2e-004
gb|BP579503.1|BP579503 BP579503 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP802341.1|BP802341 BP802341 RAFL14 Arabidopsis thaliana... 52 2e-004
dbj|AP000386.1| Arabidopsis thaliana genomic DNA, chromosom... 52 2e-004
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 52 2e-004
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 52 2e-004
gb|BP634296.1|BP634296 BP634296 RAFL17 Arabidopsis thaliana... 50 6e-004
emb|BX662707.1| Arabidopsis thaliana T-DNA flanking sequenc... 48 0.002
gb|CB074224.1|CB074224 EST01001 Virulent Peronospora parasi... 48 0.002
gb|BP570792.1|BP570792 BP570792 RAFL14 Arabidopsis thaliana... 48 0.002
gb|BP583280.1|BP583280 BP583280 RAFL14 Arabidopsis thaliana... 48 0.002
gb|BP846570.1|BP846570 BP846570 RAFL21 Arabidopsis thaliana... 48 0.002
gb|BP852362.1|BP852362 BP852362 RAFL21 Arabidopsis thaliana... 48 0.002
gb|BP865609.1|BP865609 BP865609 RAFL21 Arabidopsis thaliana... 48 0.002
gb|BP652187.1|BP652187 BP652187 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP654583.1|BP654583 BP654583 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP669978.1|BP669978 BP669978 RAFL21 Arabidopsis thaliana... 46 0.009
gb|BP777191.1|BP777191 BP777191 RAFL7 Arabidopsis thaliana ... 46 0.009
gb|BP792500.1|BP792500 BP792500 RAFL7 Arabidopsis thaliana ... 46 0.009
gb|BP816280.1|BP816280 BP816280 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP831491.1|BP831491 BP831491 RAFL19 Arabidopsis thaliana... 46 0.009
gb|BP866747.1|BP866747 BP866747 RAFL21 Arabidopsis thaliana... 46 0.009
gb|Z30474.1|Z30474 ATTS2397 Ors-A Arabidopsis thaliana cDNA... 44 0.037
gb|H76560.1|H76560 18265 Lambda-PRL2 Arabidopsis thaliana c... 44 0.037
gb|CB074863.1|CB074863 EST03016 Arabidopsis Acute Ozone poo... 44 0.037
gb|BP799075.1|BP799075 BP799075 RAFL14 Arabidopsis thaliana... 44 0.037
gb|BP799918.1|BP799918 BP799918 RAFL14 Arabidopsis thaliana... 44 0.037
gb|BP832288.1|BP832288 BP832288 RAFL19 Arabidopsis thaliana... 44 0.037
gb|BP837681.1|BP837681 BP837681 RAFL19 Arabidopsis thaliana... 44 0.037
gb|BP847962.1|BP847962 BP847962 RAFL21 Arabidopsis thaliana... 44 0.037
gb|BP852514.1|BP852514 BP852514 RAFL21 Arabidopsis thaliana... 44 0.037
gb|BP853680.1|BP853680 BP853680 RAFL21 Arabidopsis thaliana... 44 0.037
gb|BP857006.1|BP857006 BP857006 RAFL21 Arabidopsis thaliana... 44 0.037
gb|BP861363.1|BP861363 BP861363 RAFL21 Arabidopsis thaliana... 44 0.037
gb|BP862661.1|BP862661 BP862661 RAFL21 Arabidopsis thaliana... 44 0.037
gb|BP864033.1|BP864033 BP864033 RAFL21 Arabidopsis thaliana... 44 0.037
gb|BP829628.1|BP829628 BP829628 RAFL19 Arabidopsis thaliana... 42 0.15
gb|BP844967.1|BP844967 BP844967 RAFL21 Arabidopsis thaliana... 42 0.15
>gb|AV784434.1|AV784434 AV784434 RAFL5 Arabidopsis thaliana cDNA clone RAFL05-19-H05 3',
mRNA sequence
Length = 553
Score = 83.8 bits (42), Expect = 4e-014
Identities = 159/198 (80%)
Strand = Plus / Plus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 171 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 230
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| ||||||||| || || ||||| |
Sbjct: 231 caagaaggccctgacgatcctctccctaacagcaactccagatagaacaccaccatatgc 290
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 291 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 350
Query: 527 atggggaatgccctggat 544
||| ||||| || |||||
Sbjct: 351 atgcggaatcccttggat 368
>gb|AV787483.1|AV787483 AV787483 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-75-M21 3',
mRNA sequence
Length = 419
Score = 83.8 bits (42), Expect = 4e-014
Identities = 159/198 (80%)
Strand = Plus / Plus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 152 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 211
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| ||||||||| || || ||||| |
Sbjct: 212 caagaaggccctgacgatcctctccctaacagcaactccagatagaacaccaccatatgc 271
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 272 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 331
Query: 527 atggggaatgccctggat 544
||| ||||| || |||||
Sbjct: 332 atgcggaatcccttggat 349
>gb|AV823465.1|AV823465 AV823465 RAFL5 Arabidopsis thaliana cDNA clone RAFL05-19-H05 5',
mRNA sequence
Length = 592
Score = 83.8 bits (42), Expect = 4e-014
Identities = 159/198 (80%)
Strand = Plus / Minus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 385 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 326
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| ||||||||| || || ||||| |
Sbjct: 325 caagaaggccctgacgatcctctccctaacagcaactccagatagaacaccaccatatgc 266
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 265 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 206
Query: 527 atggggaatgccctggat 544
||| ||||| || |||||
Sbjct: 205 atgcggaatcccttggat 188
>gb|BU635873.1|BU635873 005A09 Infected Arabidopsis Leaf Arabidopsis thaliana cDNA, mRNA
sequence
Length = 516
Score = 83.8 bits (42), Expect = 4e-014
Identities = 159/198 (80%)
Strand = Plus / Minus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 322 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 263
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| ||||||||| || || ||||| |
Sbjct: 262 caagaaggccctgacgatcctctccctaacagcaactccagatagaacaccaccatatgc 203
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 202 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 143
Query: 527 atggggaatgccctggat 544
||| ||||| || |||||
Sbjct: 142 atgcggaatcccttggat 125
>gb|BP783102.1|BP783102 BP783102 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-84-M13 3',
mRNA sequence
Length = 421
Score = 83.8 bits (42), Expect = 4e-014
Identities = 159/198 (80%)
Strand = Plus / Plus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 193 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 252
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| ||||||||| || || ||||| |
Sbjct: 253 caagaaggccctgacgatcctctccctaacagcaactccagatagaacaccaccatatgc 312
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 313 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 372
Query: 527 atggggaatgccctggat 544
||| ||||| || |||||
Sbjct: 373 atgcggaatcccttggat 390
>gb|BP818534.1|BP818534 BP818534 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-48-G24 5',
mRNA sequence
Length = 388
Score = 83.8 bits (42), Expect = 4e-014
Identities = 159/198 (80%)
Strand = Plus / Minus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 381 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 322
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| ||||||||| || || ||||| |
Sbjct: 321 caagaaggccctgacgatcctctccctaacagcaactccagatagaacaccaccatatgc 262
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 261 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 202
Query: 527 atggggaatgccctggat 544
||| ||||| || |||||
Sbjct: 201 atgcggaatcccttggat 184
>gb|AY045818.1| Arabidopsis thaliana putative 60S ribosomal protein L34 (At3g28900)
mRNA, complete cds
Length = 568
Score = 83.8 bits (42), Expect = 4e-014
Identities = 159/198 (80%)
Strand = Plus / Minus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 382 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 323
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| ||||||||| || || ||||| |
Sbjct: 322 caagaaggccctgacgatcctctccctaacagcaactccagatagaacaccaccatatgc 263
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 262 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 203
Query: 527 atggggaatgccctggat 544
||| ||||| || |||||
Sbjct: 202 atgcggaatcccttggat 185
>gb|AY091359.1| Arabidopsis thaliana putative 60S ribosomal protein L34 (At3g28900)
mRNA, complete cds
Length = 394
Score = 83.8 bits (42), Expect = 4e-014
Identities = 159/198 (80%)
Strand = Plus / Minus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 348 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 289
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| ||||||||| || || ||||| |
Sbjct: 288 caagaaggccctgacgatcctctccctaacagcaactccagatagaacaccaccatatgc 229
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 228 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 169
Query: 527 atggggaatgccctggat 544
||| ||||| || |||||
Sbjct: 168 atgcggaatcccttggat 151
>ref|NM_113811.3| Arabidopsis thaliana structural constituent of ribosome AT3G28900
mRNA, complete cds
Length = 574
Score = 83.8 bits (42), Expect = 4e-014
Identities = 159/198 (80%)
Strand = Plus / Minus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 382 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 323
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| ||||||||| || || ||||| |
Sbjct: 322 caagaaggccctgacgatcctctccctaacagcaactccagatagaacaccaccatatgc 263
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 262 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 203
Query: 527 atggggaatgccctggat 544
||| ||||| || |||||
Sbjct: 202 atgcggaatcccttggat 185
>gb|BP587808.1|BP587808 BP587808 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-43-P18 3',
mRNA sequence
Length = 414
Score = 81.8 bits (41), Expect = 2e-013
Identities = 152/189 (80%)
Strand = Plus / Plus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 152 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 211
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| ||||||||| | || ||||| |
Sbjct: 212 caagaaggccctgacgatcctctccctaacagcaactccagatagaaaaccaccatatgc 271
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 272 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 331
Query: 527 atggggaat 535
|||||||||
Sbjct: 332 atggggaat 340
>emb|BX825772.1|CNS0A6BD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL61ZF03 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 544
Score = 77.8 bits (39), Expect = 3e-012
Identities = 144/179 (80%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| ||||||||||| |||||||||| ||| || | || |||||| ||
Sbjct: 330 ttcaaaaccttctttacaatcttctgttcttcaaccaagaaggccctgacgatcctctcc 271
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| ||| ||||||||| || || ||||| | ||| || || || || ||||||
Sbjct: 270 ctaacagcaactccagatagaacaccaccatatgcacgatttactgtcctctcgttcctt 211
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttctt 550
| |||||| ||||||||||||||||| || |||| ||| ||||| || ||||| |||||
Sbjct: 210 gccaaccttgaccttttgtactcagcaggactcaaatgcggaatcccttggattttctt 152
>gb|BP652482.1|BP652482 BP652482 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-93-E15 3',
mRNA sequence
Length = 383
Score = 75.8 bits (38), Expect = 1e-011
Identities = 158/198 (79%)
Strand = Plus / Plus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 152 agtcttctctttcggcttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 211
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| | | || |||||| || ||||| ||| |||||||||| || || ||||| |
Sbjct: 212 caagaagggcctgacgatcctctccctaacagcaattccagatagaacaccaccatatgc 271
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
| | ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 272 aggattcactgtcctctcgttccttggcaaccttgaccttttgtactcagcaggtctcaa 331
Query: 527 atggggaatgccctggat 544
||| ||||| || |||||
Sbjct: 332 atgcggaatcccttggat 349
>emb|BX825773.1|CNS0A6BE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL61ZF04 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 547
Score = 75.8 bits (38), Expect = 1e-011
Identities = 158/198 (79%)
Strand = Plus / Minus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 355 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 296
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| |||||| || || || ||||| |
Sbjct: 295 caagaaggccctgacgatcctctccctaacagcaactccagaaagaacaccaccatatgc 236
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 235 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 176
Query: 527 atggggaatgccctggat 544
||| ||||| || |||||
Sbjct: 175 atgcggaatcccttggat 158
>gb|CB259748.1|CB259748 25-E9623-013-004-A08-T7R MPIZ-ADIS-013 Arabidopsis thaliana cDNA
clone MPIZp770A084Q 5-PRIME, mRNA sequence
Length = 586
Score = 69.9 bits (35), Expect = 6e-010
Identities = 182/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||||||||| ||||| |||||
Sbjct: 373 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaagcacgaatgattctttcc 314
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 313 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 254
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 253 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 194
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 193 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 143
>gb|BP627689.1|BP627689 BP627689 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-09-I11 3',
mRNA sequence
Length = 341
Score = 69.9 bits (35), Expect = 6e-010
Identities = 138/171 (80%), Gaps = 1/171 (0%)
Strand = Plus / Plus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| |||||||| ||||||||||| ||||||||
Sbjct: 171 agtcttctctttcgccttctgaagcttcaaaaccttcttcacaatcttctgttcttcaac 230
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || ||||| ||| ||||||||| || || ||||| |
Sbjct: 231 caagaaggccctgacgatcctctccctaacagcaactccagatagaacaccaccatatgc 290
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagc 517
||| ||||| || || |||||| | |||||| |||||||||||||||||
Sbjct: 291 acgattcactgtcctctcgttccttgccaacct-gaccttttgtactcagc 340
>gb|BP866155.1|BP866155 BP866155 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-76-L10 5',
mRNA sequence
Length = 386
Score = 69.9 bits (35), Expect = 6e-010
Identities = 182/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 384 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 325
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| || || || ||||| | ||||||||| || || | ||| ||
Sbjct: 324 ctaacagcagaaccagacagaaccccaccataagcacggttcacggtcctcctgtttctt 265
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 264 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 205
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 204 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 154
>gb|BP585523.1|BP585523 BP585523 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-02-N15 3',
mRNA sequence
Length = 437
Score = 65.9 bits (33), Expect = 1e-008
Identities = 150/189 (79%)
Strand = Plus / Plus
Query: 347 agtcttgtctttggtcttctgtaatttcaacaccttcttgacaatcttctgctcttcaac 406
|||||| ||||| | |||||| | ||||| | |||||| ||||||||||| ||||||||
Sbjct: 152 agtcttctctttcgccttctgaagcttcaaaagcttcttcacaatcttctgttcttcaac 211
Query: 407 caggaaagcacggatgatcctttctctaactgcagttccagatagtactcccccataggg 466
|| ||| || | || |||||| || |||| ||| ||||||||| || || ||||| |
Sbjct: 212 caagaaggccctgacgatcctctccctaagagcaactccagatagaacaccaccatatgc 271
Query: 467 acggttcacagttctgcggttcctagacaacctggaccttttgtactcagctggcctcag 526
||| ||||| || || |||||| | |||||| ||||||||||||||||| || ||||
Sbjct: 272 acgattcactgtcctctcgttccttgccaaccttgaccttttgtactcagcaggtctcaa 331
Query: 527 atggggaat 535
||| |||||
Sbjct: 332 atgcggaat 340
>gb|BP828332.1|BP828332 BP828332 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-78-H23 5',
mRNA sequence
Length = 377
Score = 65.9 bits (33), Expect = 1e-008
Identities = 139/173 (80%), Gaps = 1/173 (0%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| ||||||||||| |||||||||| ||| || | || |||||| ||
Sbjct: 354 ttcaaaaccttcttcacaatcttctgttcttcaaccaagaaggccctgacgatcctctcc 295
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| ||| ||||||||| || || ||||| | ||| ||||| || || ||||||
Sbjct: 294 ctaacagcaactccagatagaacaccaccatatgcacgattcactgtcctctcgttcctt 235
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggat 544
| |||||| |||||||| |||||||| || |||| ||| ||||| || |||||
Sbjct: 234 gccaaccttgacctttt-tactcagcaggtctcaaatgcggaatcccttggat 183
>gb|F20073.1|F20073 ATTS6112 AC16H Arabidopsis thaliana cDNA clone TAP0238 similar to
ribosomal protein L34, mRNA sequence
Length = 554
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 329 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 270
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 269 cctgactgcag 259
>gb|N96599.1|N96599 21274 Lambda-PRL1 Arabidopsis thaliana cDNA clone F10F1T7, mRNA
sequence
Length = 479
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 158 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 217
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 218 cctgactgcag 228
>gb|AI994094.1|AI994094 701498663 A. thaliana, Ohio State clone set Arabidopsis thaliana
cDNA clone 701498663, mRNA sequence
Length = 542
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 373 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 314
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 313 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 254
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 253 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 194
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 193 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 143
>gb|AI995012.1|AI995012 701501452 A. thaliana, Ohio State clone set Arabidopsis thaliana
cDNA clone 701501452, mRNA sequence
Length = 584
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 334 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 275
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 274 cctgactgcag 264
>gb|BE039060.1|BE039060 AB09B02 AB Arabidopsis thaliana cDNA 5' similar to 60s ribosomal
protein l34, mRNA sequence
Length = 705
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 376 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 317
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 316 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 257
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 256 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 197
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 196 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 146
>gb|AV787370.1|AV787370 AV787370 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-75-E07 3',
mRNA sequence
Length = 423
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Plus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 155 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 214
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 215 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 274
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 275 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 334
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 335 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 385
>gb|CB262293.1|CB262293 66-E8879-008-014-C18-pBl2 MPIZ-ADIS-008 Arabidopsis thaliana cDNA
clone MPIZp767C1814Q 5-PRIME, mRNA sequence
Length = 446
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 314 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 255
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 254 cctgactgcag 244
>gb|CB264494.1|CB264494 58-E014994-035-003-C16-T7R MPIZ-ADIS-035 Arabidopsis thaliana cDNA
clone MPIZp2000C163Q 5-PRIME, mRNA sequence
Length = 608
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 317 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 258
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 257 cctgactgcag 247
>gb|BX836706.1|BX836706 BX836706 Arabidopsis thaliana Flowers and buds Col-0 Arabidopsis
thaliana cDNA clone GSLTFB10ZG06 3PRIM, mRNA sequence
Length = 540
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 269 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 328
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 329 cctgactgcag 339
>gb|AV526629.1|AV526629 AV526629 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ17h09R 5', mRNA
sequence
Length = 498
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 373 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 314
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 313 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 254
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 253 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 194
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 193 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 143
>gb|AV532287.1|AV532287 AV532287 Arabidopsis thaliana flower buds Columbia Arabidopsis
thaliana cDNA clone FB039f07F 3', mRNA sequence
Length = 456
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Plus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 141 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 200
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 201 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 260
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 261 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 320
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 321 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 371
>gb|AV533399.1|AV533399 AV533399 Arabidopsis thaliana flower buds Columbia Arabidopsis
thaliana cDNA clone FB061a01F 3', mRNA sequence
Length = 514
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 374 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 315
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 314 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 255
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 254 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 195
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 194 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 144
>gb|AV534396.1|AV534396 AV534396 Arabidopsis thaliana flower buds Columbia Arabidopsis
thaliana cDNA clone FB079e07F 3', mRNA sequence
Length = 431
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Plus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 190 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 249
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 250 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 309
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 310 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 369
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 370 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 420
>gb|AV537579.1|AV537579 AV537579 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ09b03F 3', mRNA sequence
Length = 506
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 192 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 251
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 252 cctgactgcag 262
>gb|BP561283.1|BP561283 BP561283 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-75-E07 5',
mRNA sequence
Length = 538
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 384 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 325
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 324 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 265
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 264 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 205
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 204 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 154
>gb|BP574454.1|BP574454 BP574454 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-88-B18 3',
mRNA sequence
Length = 433
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 277 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 336
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 337 cctgactgcag 347
>gb|BP582226.1|BP582226 BP582226 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-35-F16 3',
mRNA sequence
Length = 419
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Plus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 168 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 227
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 228 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 287
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 288 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 347
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 348 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 398
>gb|BP583743.1|BP583743 BP583743 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-42-O05 3',
mRNA sequence
Length = 421
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Plus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 148 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 207
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 208 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 267
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 268 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 327
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 328 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 378
>gb|BP624822.1|BP624822 BP624822 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-41-K16 3',
mRNA sequence
Length = 420
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 243 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 302
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 303 cctgactgcag 313
>gb|BP624999.1|BP624999 BP624999 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-42-E09 3',
mRNA sequence
Length = 428
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 216 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 275
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 276 cctgactgcag 286
>gb|BP792167.1|BP792167 BP792167 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-50-L11 3',
mRNA sequence
Length = 402
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Plus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 156 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 215
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 216 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 275
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 276 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 335
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 336 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 386
>gb|BP818794.1|BP818794 BP818794 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-49-D16 5',
mRNA sequence
Length = 401
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 343 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 284
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 283 cctgactgcag 273
>gb|BP833469.1|BP833469 BP833469 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-96-F15 5',
mRNA sequence
Length = 385
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 370 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 311
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 310 cctgactgcag 300
>gb|BP834364.1|BP834364 BP834364 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-99-K10 5',
mRNA sequence
Length = 396
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 386 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 327
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| || || ||||| | ||||||||| ||||| | ||| ||
Sbjct: 326 ctaacagcagaaccagaccaaaccccaccataagcacggttcacggttctcctgtttctt 267
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 266 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 207
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 206 ccggtaacgggacatttaggtccactagctctcttctttgtggtctggtac 156
>gb|BP868072.1|BP868072 BP868072 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-83-C08 5',
mRNA sequence
Length = 388
Score = 61.9 bits (31), Expect = 2e-007
Identities = 175/223 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 384 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 325
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 324 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 265
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 264 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 205
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgt 594
||||| |||||||| || || || || ||||||||||| ||||
Sbjct: 204 ccggtaacgggacatttaggtccactagctctcttcttagtgt 162
>gb|AF324703.1|AF324703 Arabidopsis thaliana T6C23.18 mRNA, complete cds
Length = 599
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 385 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 326
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 325 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 266
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 265 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 206
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 205 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 155
>gb|AY052720.1| Arabidopsis thaliana F24J1.23/F24J1.23 mRNA, complete cds
Length = 539
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 385 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 326
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 325 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 266
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 265 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 206
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 205 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 155
>gb|AF446885.1|AF446885 Arabidopsis thaliana F24J1.23/F24J1.23 mRNA, complete cds
Length = 360
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 323 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 264
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 263 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 204
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 203 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 144
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 143 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 93
>gb|AF327531.1| Arabidopsis thaliana putative 60S ribosomal protein L34 (At1g69620)
mRNA, complete cds
Length = 598
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 384 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 325
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 324 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 265
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 264 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 205
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 204 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 154
>gb|AF349526.1| Arabidopsis thaliana putative 60S ribosomal protein L34 (At1g69620)
mRNA, complete cds
Length = 410
Score = 61.9 bits (31), Expect = 2e-007
Identities = 181/231 (78%)
Strand = Plus / Minus
Query: 372 ttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttct 431
||||| |||||||| |||||||| ||||| || || ||||| ||||| ||||| |||||
Sbjct: 323 ttcaaaaccttcttcacaatcttttgctcctccacaaggaaggcacgaatgattctttcc 264
Query: 432 ctaactgcagttccagatagtactcccccatagggacggttcacagttctgcggttccta 491
||||| |||| ||||| | || || ||||| | ||||||||| || || | ||| ||
Sbjct: 263 ctaacagcagaaccagacaaaaccccaccataagcacggttcacggtcctcctgtttctt 204
Query: 492 gacaacctggaccttttgtactcagctggcctcagatggggaatgccctggatcttcttc 551
|| || | ||||| |||||||||| |||||||| || ||||| ||||| || |||
Sbjct: 203 gataaacgtgacctcttgtactcagttggcctcaagtgaggaataccctgaatacgcttg 144
Query: 552 ccggtcacgggacacttgggcccgctggctctcttcttggtgtactggtac 602
||||| |||||||| || || || || ||||||||||| ||| |||||||
Sbjct: 143 ccggtaacgggacatttaggtccactagctctcttcttagtggtctggtac 93
>gb|AY080712.1| Arabidopsis thaliana putative 60s ribosomal protein L34 (At1g26880)
mRNA, complete cds
Length = 653
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 345 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 286
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 285 cctgactgcag 275
>gb|AY117327.1| Arabidopsis thaliana putative 60S ribosomal protein L34 (At1g26880)
mRNA, complete cds
Length = 394
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 371 tttcaacaccttcttgacaatcttctgctcttcaaccaggaaagcacggatgatcctttc 430
||||||||| ||||| |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 324 tttcaacactttcttcacaatcttttgctcttcgacaaggaatgcccgaatgatcctttc 265
Query: 431 tctaactgcag 441
|| |||||||
Sbjct: 264 cctgactgcag 254
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 375,799
Number of Sequences: 1013581
Number of extensions: 375799
Number of successful extensions: 29489
Number of sequences better than 0.5: 119
Number of HSP's better than 0.5 without gapping: 116
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 29039
Number of HSP's gapped (non-prelim): 448
length of query: 803
length of database: 908,940,872
effective HSP length: 20
effective length of query: 783
effective length of database: 888,669,252
effective search space: 695828024316
effective search space used: 695828024316
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)