BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2521918.2.1
         (417 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|BX662728.1|  Arabidopsis thaliana T-DNA flanking sequenc...    52   8e-005
gb|CB074582.1|CB074582  EST0088 Virulent Peronospora parasit...    52   8e-005
gb|CB074854.1|CB074854  EST03007 Arabidopsis Acute Ozone poo...    52   8e-005
gb|CB074862.1|CB074862  EST03015 Arabidopsis Acute Ozone poo...    52   8e-005
emb|BX662824.1|  Arabidopsis thaliana T-DNA flanking sequenc...    50   3e-004
gb|BE662730.1|BE662730  EST00251 Arabidopsis Acute Ozone Rev...    50   3e-004
gb|BE662731.1|BE662731  EST00252 Arabidopsis Acute Ozone Rev...    50   3e-004
gb|BE662737.1|BE662737  EST00258 Arabidopsis Acute Ozone Rev...    50   3e-004
gb|CB185880.1|CB185880  EST01071 Arabidopsis virulent Pseudo...    50   3e-004
gb|CB239324.1|CB239324  EST01145 Arabidopsis virulent Pseudo...    50   3e-004
gb|CB074223.1|CB074223  EST01000 Virulent Peronospora parasi...    50   3e-004
gb|CB074411.1|CB074411  EST00927 Virulent Peronospora parasi...    50   3e-004
gb|CB074863.1|CB074863  EST03016 Arabidopsis Acute Ozone poo...    50   3e-004
gb|CB165160.1|CB165160  EST00996 Virulent Peronospora parasi...    50   3e-004
gb|CF772955.1|CF772955  AG_FSL_10D03 Arabidopsis ag-1 35S:AG...    50   3e-004
gb|CB074186.1|CB074186  EST02508 Early Ovule Development For...    48   0.001
gb|CB074279.1|CB074279  EST00792 Virulent Peronospora parasi...    48   0.001
gb|CB097368.1|CB097368  EST00995 Virulent Peronospora parasi...    48   0.001
emb|AX505609.1|  Sequence 304 from Patent WO0216655                48   0.001
emb|AX507774.1|  Sequence 2469 from Patent WO0216655               48   0.001
gb|CB185793.2|CB185793  EST00720 Arabidopsis avirulent Pseud...    46   0.005
gb|CB185942.1|CB185942  EST01133 Arabidopsis virulent Pseudo...    46   0.005
gb|CB185943.1|CB185943  EST01134 Arabidopsis virulent Pseudo...    46   0.005
gb|CB074227.1|CB074227  EST01003 Virulent Peronospora parasi...    46   0.005
gb|U58918.1|ATU58918  Arabidopsis thaliana MEK kinase (MAP3K...    46   0.005
emb|AJ010090.1|ATH010090  Arabidopsis thaliana mRNA for MAP3...    46   0.005
emb|CS137270.1|  Sequence 241 from Patent WO2005047516             46   0.005
emb|AJ595464.1|  Arabidopsis thaliana T-DNA flanking sequenc...    44   0.019
emb|BX663278.1|  Arabidopsis thaliana T-DNA flanking sequenc...    44   0.019
gb|BE662936.1|BE662936  EST00086 Arabidopsis Acute Ozone For...    44   0.019
gb|CF772990.1|CF772990  AG_FSL_10G03 Arabidopsis ag-1 35S:AG...    44   0.019
emb|AJ272202.1|ATH272202  Arabidopsis thaliana mRNA for mito...    44   0.019
emb|AJ293797.1|ATH293797  Arabidopsis thaliana mRNA for SC35...    44   0.019
emb|AJ590285.1|  Arabidopsis thaliana T-DNA flanking sequenc...    40   0.29 
gb|CB185798.1|CB185798  EST00725 Arabidopsis avirulent Pseud...    40   0.29 
gb|CB185800.1|CB185800  EST00727 Arabidopsis avirulent Pseud...    40   0.29 
emb|AJ836339.1|  Arabidopsis thaliana T-DNA flanking sequenc...    40   0.29 
emb|AJ836963.1|  Arabidopsis thaliana T-DNA flanking sequenc...    40   0.29 
emb|AJ837158.1|  Arabidopsis thaliana T-DNA flanking sequenc...    40   0.29 
emb|AJ837256.1|  Arabidopsis thaliana T-DNA flanking sequenc...    40   0.29 
emb|AJ840712.1|  Arabidopsis thaliana T-DNA flanking sequenc...    40   0.29 
>emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequence GK-708B12-022965,
           genomic survey sequence
          Length = 378

 Score = 52.0 bits (26), Expect = 8e-005
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 392 agtacctgcccgggcggccgctcgaa 417
           ||||||||||||||||||||||||||
Sbjct: 52  agtacctgcccgggcggccgctcgaa 27
>gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasitica Infected Arabidopsis
           Forward-Subtracted Library Arabidopsis thaliana cDNA
           clone VPP-EB10, mRNA sequence
          Length = 406

 Score = 52.0 bits (26), Expect = 8e-005
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 392 agtacctgcccgggcggccgctcgaa 417
           ||||||||||||||||||||||||||
Sbjct: 381 agtacctgcccgggcggccgctcgaa 406
>gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone pooled time-points
           Forward-Subtracted Library Arabidopsis thaliana cDNA
           clone AtAOzLC01 similar to PSII 32Kda protein, mRNA
           sequence
          Length = 358

 Score = 52.0 bits (26), Expect = 8e-005
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 392 agtacctgcccgggcggccgctcgaa 417
           ||||||||||||||||||||||||||
Sbjct: 328 agtacctgcccgggcggccgctcgaa 353
>gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone pooled time-points
           Forward-Subtracted Library Arabidopsis thaliana cDNA
           clone AtAOzLH04 similar to PsbA gene in chloroplast
           genome, mRNA sequence
          Length = 360

 Score = 52.0 bits (26), Expect = 8e-005
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 392 agtacctgcccgggcggccgctcgaa 417
           ||||||||||||||||||||||||||
Sbjct: 331 agtacctgcccgggcggccgctcgaa 356
>emb|BX662824.1| Arabidopsis thaliana T-DNA flanking sequence GK-708H07-022965,
           genomic survey sequence
          Length = 416

 Score = 50.1 bits (25), Expect = 3e-004
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 393 gtacctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||||
Sbjct: 52  gtacctgcccgggcggccgctcgaa 28
>gb|BE662730.1|BE662730 EST00251 Arabidopsis Acute Ozone Reverse-Subtracted Library
           Arabidopsis thaliana cDNA clone AtAOzHA7 similar to
           small nuclear ribosomal protein E, mRNA sequence
          Length = 263

 Score = 50.1 bits (25), Expect = 3e-004
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 393 gtacctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||||
Sbjct: 239 gtacctgcccgggcggccgctcgaa 263
>gb|BE662731.1|BE662731 EST00252 Arabidopsis Acute Ozone Reverse-Subtracted Library
           Arabidopsis thaliana cDNA clone AtAOzHA9, mRNA sequence
          Length = 328

 Score = 50.1 bits (25), Expect = 3e-004
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 393 gtacctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||||
Sbjct: 304 gtacctgcccgggcggccgctcgaa 328
>gb|BE662737.1|BE662737 EST00258 Arabidopsis Acute Ozone Reverse-Subtracted Library
           Arabidopsis thaliana cDNA clone AtaOzHC2 similar to
           Lhca2 chlorophyll a/b-binding protein, mRNA sequence
          Length = 450

 Score = 50.1 bits (25), Expect = 3e-004
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 393 gtacctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||||
Sbjct: 81  gtacctgcccgggcggccgctcgaa 57
>gb|CB185880.1|CB185880 EST01071 Arabidopsis virulent Pseudomonas syringae subtracted
           library Arabidopsis thaliana cDNA clone DC4-H4 similar
           to putative protein with homology to rubisco small
           subunit, mRNA sequence
          Length = 370

 Score = 50.1 bits (25), Expect = 3e-004
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 393 gtacctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||||
Sbjct: 84  gtacctgcccgggcggccgctcgaa 60
>gb|CB239324.1|CB239324 EST01145 Arabidopsis virulent Pseudomonas syringae subtracted
           library Arabidopsis thaliana cDNA clone DC1-C2 similar
           to putative tyrosine aminotransferase, mRNA sequence
          Length = 579

 Score = 50.1 bits (25), Expect = 3e-004
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 393 gtacctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||||
Sbjct: 59  gtacctgcccgggcggccgctcgaa 35
>gb|CB074223.1|CB074223 EST01000 Virulent Peronospora parasitica Infected Arabidopsis
           reverse-Subtracted Library Arabidopsis thaliana cDNA
           clone VPP-RAA10 similar to chlorophyll a/b-binding
           protein, mRNA sequence
          Length = 527

 Score = 50.1 bits (25), Expect = 3e-004
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 393 gtacctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||||
Sbjct: 366 gtacctgcccgggcggccgctcgaa 390
>gb|CB074411.1|CB074411 EST00927 Virulent Peronospora parasitica Infected Arabidopsis
           Forward-Subtracted Library Arabidopsis thaliana cDNA
           clone VPP-FF9 similar to UNKNOWN PROTEIN, mRNA sequence
          Length = 421

 Score = 50.1 bits (25), Expect = 3e-004
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 393 gtacctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||||
Sbjct: 397 gtacctgcccgggcggccgctcgaa 421
>gb|CB074863.1|CB074863 EST03016 Arabidopsis Acute Ozone pooled time-points
           Forward-Subtracted Library Arabidopsis thaliana cDNA
           clone AtAOzLH10 similar to putative protein, mRNA
           sequence
          Length = 305

 Score = 50.1 bits (25), Expect = 3e-004
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 393 gtacctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||||
Sbjct: 278 gtacctgcccgggcggccgctcgaa 302
>gb|CB165160.1|CB165160 EST00996 Virulent Peronospora parasitica Infected Arabidopsis
           Forward-Subtracted Library Arabidopsis thaliana cDNA
           clone VPP-EH12 similar to putative protein, mRNA
           sequence
          Length = 271

 Score = 50.1 bits (25), Expect = 3e-004
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 393 gtacctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||||
Sbjct: 247 gtacctgcccgggcggccgctcgaa 271
>gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG-GR forward subtraction library
           Arabidopsis thaliana cDNA clone 10D03, mRNA sequence
          Length = 640

 Score = 50.1 bits (25), Expect = 3e-004
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 392 agtacctgcccgggcggccgctcga 416
           |||||||||||||||||||||||||
Sbjct: 122 agtacctgcccgggcggccgctcga 146
>gb|CB074186.1|CB074186 EST02508 Early Ovule Development Forward Subtracted Library
           Arabidopsis thaliana cDNA clone 1D17G5 similar to blue
           copper protein, mRNA sequence
          Length = 149

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 393 gtacctgcccgggcggccgctcga 416
           ||||||||||||||||||||||||
Sbjct: 33  gtacctgcccgggcggccgctcga 10
>gb|CB074279.1|CB074279 EST00792 Virulent Peronospora parasitica Infected Arabidopsis
           Forward-Subtracted Library Arabidopsis thaliana cDNA
           clone VPP-BB7 similar to PUTATIVE PROTEIN, mRNA sequence
          Length = 320

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 393 gtacctgcccgggcggccgctcga 416
           ||||||||||||||||||||||||
Sbjct: 213 gtacctgcccgggcggccgctcga 236
>gb|CB097368.1|CB097368 EST00995 Virulent Peronospora parasitica Infected Arabidopsis
           Forward-Subtracted Library Arabidopsis thaliana cDNA
           clone VPP-AA5 similar to NAD dependent epimerase, mRNA
           sequence
          Length = 601

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 393 gtacctgcccgggcggccgctcga 416
           ||||||||||||||||||||||||
Sbjct: 452 gtacctgcccgggcggccgctcga 475
>emb|AX505609.1| Sequence 304 from Patent WO0216655
          Length = 414

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 394 tacctgcccgggcggccgctcgaa 417
           ||||||||||||||||||||||||
Sbjct: 29  tacctgcccgggcggccgctcgaa 6
>emb|AX507774.1| Sequence 2469 from Patent WO0216655
          Length = 238

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 393 gtacctgcccgggcggccgctcga 416
           ||||||||||||||||||||||||
Sbjct: 24  gtacctgcccgggcggccgctcga 1
>gb|CB185793.2|CB185793 EST00720 Arabidopsis avirulent Pseudomonas syringae subtracted
           library Arabidopsis thaliana cDNA clone RPM3-G9 similar
           to ARF GAP-like zinc finger-containing protein (ZIGA2),
           mRNA sequence
          Length = 746

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 395 acctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||
Sbjct: 69  acctgcccgggcggccgctcgaa 47
>gb|CB185942.1|CB185942 EST01133 Arabidopsis virulent Pseudomonas syringae subtracted
           library Arabidopsis thaliana cDNA clone DC8-G7 similar
           to putative 60S ribosomal protein L18, mRNA sequence
          Length = 602

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 395 acctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||
Sbjct: 68  acctgcccgggcggccgctcgaa 46
>gb|CB185943.1|CB185943 EST01134 Arabidopsis virulent Pseudomonas syringae subtracted
           library Arabidopsis thaliana cDNA clone DC8-H5 similar
           to WD repeat domain containing protein, mRNA sequence
          Length = 473

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 395 acctgcccgggcggccgctcgaa 417
           |||||||||||||||||||||||
Sbjct: 339 acctgcccgggcggccgctcgaa 361
>gb|CB074227.1|CB074227 EST01003 Virulent Peronospora parasitica Infected Arabidopsis
           reverse-Subtracted Library Arabidopsis thaliana cDNA
           clone VPP-RBC07 similar to PSI subunit, mRNA sequence
          Length = 249

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 393 gtacctgcccgggcggccgctcg 415
           |||||||||||||||||||||||
Sbjct: 224 gtacctgcccgggcggccgctcg 246
>gb|U58918.1|ATU58918 Arabidopsis thaliana MEK kinase (MAP3Ka) mRNA, complete cds
          Length = 2267

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 394 tacctgcccgggcggccgctcga 416
           |||||||||||||||||||||||
Sbjct: 36  tacctgcccgggcggccgctcga 14
>emb|AJ010090.1|ATH010090 Arabidopsis thaliana mRNA for MAP3K alpha protein kinase
          Length = 2189

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 394 tacctgcccgggcggccgctcga 416
           |||||||||||||||||||||||
Sbjct: 36  tacctgcccgggcggccgctcga 14
>emb|CS137270.1| Sequence 241 from Patent WO2005047516
          Length = 1371

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 394 tacctgcccgggcggccgctcga 416
           |||||||||||||||||||||||
Sbjct: 276 tacctgcccgggcggccgctcga 254

 Score = 44.1 bits (22), Expect = 0.019
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 395 acctgcccgggcggccgctcga 416
           ||||||||||||||||||||||
Sbjct: 170 acctgcccgggcggccgctcga 149
>emb|AJ595464.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
           417C12, genomic survey sequence
          Length = 541

 Score = 44.1 bits (22), Expect = 0.019
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 395 acctgcccgggcggccgctcga 416
           ||||||||||||||||||||||
Sbjct: 1   acctgcccgggcggccgctcga 22
>emb|BX663278.1| Arabidopsis thaliana T-DNA flanking sequence GK-712A09-022963,
           genomic survey sequence
          Length = 278

 Score = 44.1 bits (22), Expect = 0.019
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 393 gtacctgcccgggcggccgctc 414
           ||||||||||||||||||||||
Sbjct: 199 gtacctgcccgggcggccgctc 220
>gb|BE662936.1|BE662936 EST00086 Arabidopsis Acute Ozone Forward-Subtracted Library
           Arabidopsis thaliana cDNA clone AtAOzD61, mRNA sequence
          Length = 255

 Score = 44.1 bits (22), Expect = 0.019
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 393 gtacctgcccgggcggccgctc 414
           ||||||||||||||||||||||
Sbjct: 170 gtacctgcccgggcggccgctc 191
>gb|CF772990.1|CF772990 AG_FSL_10G03 Arabidopsis ag-1 35S:AG-GR forward subtraction library
           Arabidopsis thaliana cDNA clone 10G03, mRNA sequence
          Length = 329

 Score = 44.1 bits (22), Expect = 0.019
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 393 gtacctgcccgggcggccgctcgaa 417
           |||||||||||||||| ||||||||
Sbjct: 290 gtacctgcccgggcggncgctcgaa 314
>emb|AJ272202.1|ATH272202 Arabidopsis thaliana mRNA for mitochondrial half-ABC transporter
            (STA1 gene)
          Length = 2452

 Score = 44.1 bits (22), Expect = 0.019
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 395  acctgcccgggcggccgctcga 416
            ||||||||||||||||||||||
Sbjct: 2394 acctgcccgggcggccgctcga 2415
>emb|AJ293797.1|ATH293797 Arabidopsis thaliana mRNA for SC35-like splicing factor SCL28, 28
           kD
          Length = 1122

 Score = 44.1 bits (22), Expect = 0.019
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 395 acctgcccgggcggccgctcga 416
           ||||||||||||||||||||||
Sbjct: 36  acctgcccgggcggccgctcga 15
>emb|AJ590285.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
           566D06, genomic survey sequence
          Length = 275

 Score = 40.1 bits (20), Expect = 0.29
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 110 agcaacaccaacgttgttgatcat 133
           ||||||||||||| ||||||||||
Sbjct: 183 agcaacaccaacgctgttgatcat 160
>gb|CB185798.1|CB185798 EST00725 Arabidopsis avirulent Pseudomonas syringae subtracted
           library Arabidopsis thaliana cDNA clone AVR2-A8 similar
           to hypothetical protein targeted to chloroplast, mRNA
           sequence
          Length = 456

 Score = 40.1 bits (20), Expect = 0.29
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 393 gtacctgcccgggcggccgc 412
           ||||||||||||||||||||
Sbjct: 436 gtacctgcccgggcggccgc 455
>gb|CB185800.1|CB185800 EST00727 Arabidopsis avirulent Pseudomonas syringae subtracted
           library Arabidopsis thaliana cDNA clone AVR2-B3 similar
           to hypothetical protein, mRNA sequence
          Length = 464

 Score = 40.1 bits (20), Expect = 0.29
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 393 gtacctgcccgggcggccgctcg 415
           ||||||||||||| |||||||||
Sbjct: 76  gtacctgcccgggnggccgctcg 54
>emb|AJ836339.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
           212B04
          Length = 239

 Score = 40.1 bits (20), Expect = 0.29
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 393 gtacctgcccgggcggccgctcga 416
           |||||| |||||||||||||||||
Sbjct: 106 gtacctacccgggcggccgctcga 129
>emb|AJ836963.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
           258C06
          Length = 244

 Score = 40.1 bits (20), Expect = 0.29
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 393 gtacctgcccgggcggccgctcga 416
           |||||| |||||||||||||||||
Sbjct: 165 gtacctccccgggcggccgctcga 188
>emb|AJ837158.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
           270E01
          Length = 488

 Score = 40.1 bits (20), Expect = 0.29
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 393 gtacctgcccgggcggccgctcga 416
           |||||| |||||||||||||||||
Sbjct: 421 gtacctccccgggcggccgctcga 444
>emb|AJ837256.1| Arabidopsis thaliana T-DNA flanking sequence, right border, clone
           274B01
          Length = 351

 Score = 40.1 bits (20), Expect = 0.29
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 393 gtacctgcccgggcggccgctcga 416
           |||||| |||||||||||||||||
Sbjct: 230 gtacctccccgggcggccgctcga 253
>emb|AJ840712.1| Arabidopsis thaliana T-DNA flanking sequence, right border, clone
           608A06
          Length = 786

 Score = 40.1 bits (20), Expect = 0.29
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 393 gtacctgcccgggcggccgctcga 416
           |||||| |||||||||||||||||
Sbjct: 448 gtacctccccgggcggccgctcga 471
  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 187,410
Number of Sequences: 1013581
Number of extensions: 187410
Number of successful extensions: 15388
Number of sequences better than  0.5: 41
Number of HSP's better than  0.5 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15341
Number of HSP's gapped (non-prelim): 47
length of query: 417
length of database: 908,940,872
effective HSP length: 20
effective length of query: 397
effective length of database: 888,669,252
effective search space: 352801693044
effective search space used: 352801693044
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)