BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2493695.2.1
(570 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|B19943.1|B19943 T14L14-Sp6 TAMU Arabidopsis thaliana gen... 40 0.40
gb|AQ957253.1|AQ957253 LERAO74TF LERA Arabidopsis thaliana ... 40 0.40
gb|AQ958603.1|AQ958603 LERAY57TF LERA Arabidopsis thaliana ... 40 0.40
gb|BH244352.1|BH244352 ATZEE57TF ATZE Arabidopsis thaliana ... 40 0.40
gb|BH244570.1|BH244570 ATZEB62TR ATZE Arabidopsis thaliana ... 40 0.40
gb|BH244591.1|BH244591 ATZEB17TR ATZE Arabidopsis thaliana ... 40 0.40
gb|BH250858.1|BH250858 SALK_010616 Arabidopsis thaliana TDN... 40 0.40
gb|CL466322.1|CL466322 SAIL_1254_B06.v1 SAIL Collection Ara... 40 0.40
gb|CL493439.1|CL493439 SAIL_57_D02.v1 SAIL Collection Arabi... 40 0.40
emb|AL936052.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.40
emb|AL936953.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.40
emb|AL937994.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.40
emb|AL949659.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.40
emb|BX001966.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.40
emb|BX287515.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.40
dbj|AP000423.1| Arabidopsis thaliana chloroplast genomic DN... 40 0.40
ref|NC_000932.1| Arabidopsis thaliana chloroplast, complete... 40 0.40
>gb|B19943.1|B19943 T14L14-Sp6 TAMU Arabidopsis thaliana genomic clone T14L14, DNA
sequence
Length = 911
Score = 40.1 bits (20), Expect = 0.40
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 279 ggaagggaaggggaaggagaagga 302
|||||| |||||||||||||||||
Sbjct: 640 ggaaggaaaggggaaggagaagga 617
>gb|AQ957253.1|AQ957253 LERAO74TF LERA Arabidopsis thaliana genomic clone LERAO74, DNA
sequence
Length = 737
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 149 gaaggggaaggagaaggagt 130
>gb|AQ958603.1|AQ958603 LERAY57TF LERA Arabidopsis thaliana genomic clone LERAY57, DNA
sequence
Length = 241
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 46 gaaggggaaggagaaggagt 27
>gb|BH244352.1|BH244352 ATZEE57TF ATZE Arabidopsis thaliana genomic clone ATZEE57, DNA
sequence
Length = 413
Score = 40.1 bits (20), Expect = 0.40
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 207 cccctcggcagcggcggcggcggc 230
||||||||| ||||||||||||||
Sbjct: 305 cccctcggcggcggcggcggcggc 282
>gb|BH244570.1|BH244570 ATZEB62TR ATZE Arabidopsis thaliana genomic clone ATZEB62, DNA
sequence
Length = 605
Score = 40.1 bits (20), Expect = 0.40
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 207 cccctcggcagcggcggcggcggc 230
||||||||| ||||||||||||||
Sbjct: 140 cccctcggcggcggcggcggcggc 163
>gb|BH244591.1|BH244591 ATZEB17TR ATZE Arabidopsis thaliana genomic clone ATZEB17, DNA
sequence
Length = 483
Score = 40.1 bits (20), Expect = 0.40
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 207 cccctcggcagcggcggcggcggc 230
||||||||| ||||||||||||||
Sbjct: 199 cccctcggcggcggcggcggcggc 222
>gb|BH250858.1|BH250858 SALK_010616 Arabidopsis thaliana TDNA insertion lines Arabidopsis
thaliana genomic clone SALK_010616, DNA sequence
Length = 576
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 410 gaaggggaaggagaaggagt 429
>gb|CL466322.1|CL466322 SAIL_1254_B06.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_1254_B06.v1, DNA sequence
Length = 1048
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 283 gggaaggggaaggagaagga 302
||||||||||||||||||||
Sbjct: 1025 gggaaggggaaggagaagga 1006
>gb|CL493439.1|CL493439 SAIL_57_D02.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_57_D02.v1, DNA sequence
Length = 897
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 212 cggcagcggcggcggcggcc 231
||||||||||||||||||||
Sbjct: 541 cggcagcggcggcggcggcc 522
>emb|AL936052.1| Arabidopsis thaliana T-DNA flanking sequence GK-017A09-017012,
genomic survey sequence
Length = 261
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 186 gaaggggaaggagaaggagt 205
>emb|AL936953.1| Arabidopsis thaliana T-DNA flanking sequence GK-062E03-016100,
genomic survey sequence
Length = 399
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 221 gaaggggaaggagaaggagt 240
>emb|AL937994.1| Arabidopsis thaliana T-DNA flanking sequence GK-231E12-014317,
genomic survey sequence
Length = 364
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 275 gaaggggaaggagaaggagt 294
>emb|AL949659.1| Arabidopsis thaliana T-DNA flanking sequence GK-322D04-015950,
genomic survey sequence
Length = 366
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 291 gaaggggaaggagaaggagt 310
>emb|BX001966.1| Arabidopsis thaliana T-DNA flanking sequence GK-360D01-016880,
genomic survey sequence
Length = 402
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 321 gaaggggaaggagaaggagt 340
>emb|BX287515.1| Arabidopsis thaliana T-DNA flanking sequence GK-402B11-017817,
genomic survey sequence
Length = 484
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 406 gaaggggaaggagaaggagt 425
>dbj|AP000423.1| Arabidopsis thaliana chloroplast genomic DNA, complete sequence,
strain:Columbia
Length = 154478
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 145974 gaaggggaaggagaaggagt 145955
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 92675 gaaggggaaggagaaggagt 92694
>ref|NC_000932.1| Arabidopsis thaliana chloroplast, complete genome
Length = 154478
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 145974 gaaggggaaggagaaggagt 145955
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 285 gaaggggaaggagaaggagt 304
||||||||||||||||||||
Sbjct: 92675 gaaggggaaggagaaggagt 92694
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 202,366
Number of Sequences: 1013581
Number of extensions: 202366
Number of successful extensions: 22122
Number of sequences better than 0.5: 17
Number of HSP's better than 0.5 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22071
Number of HSP's gapped (non-prelim): 45
length of query: 570
length of database: 908,940,872
effective HSP length: 20
effective length of query: 550
effective length of database: 888,669,252
effective search space: 488768088600
effective search space used: 488768088600
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)