BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2493531.2.1
         (1061 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|BX826449.1|CNS0A49I  Arabidopsis thaliana Full-length cD...    46   0.012
gb|BH236132.1|BH236132  ATZKD96TR ATZK Arabidopsis thaliana ...    44   0.049
gb|BT004312.1|  Arabidopsis thaliana clone RAFL16-03-D02 (R5...    44   0.049
gb|BT005624.1|  Arabidopsis thaliana clone U50144 unknown pr...    44   0.049
emb|BX831345.1|CNS09YRH  Arabidopsis thaliana Full-length cD...    44   0.049
dbj|BA000015.5|  Arabidopsis thaliana DNA, chromosome 5, com...    44   0.049
emb|AL162506.1|ATF17C15  Arabidopsis thaliana DNA chromosome...    44   0.049
ref|NM_120448.2|  Arabidopsis thaliana unknown protein AT5G0...    44   0.049
ref|NC_003076.4|  Arabidopsis thaliana chromosome 5, complet...    44   0.049
gb|B19307.1|B19307  F1F22-T7 IGF Arabidopsis thaliana genomi...    42   0.19 
gb|BP827278.1|BP827278  BP827278 RAFL19 Arabidopsis thaliana...    42   0.19 
emb|BX827391.1|CNS0A2DD  Arabidopsis thaliana Full-length cD...    42   0.19 
>emb|BX826449.1|CNS0A49I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB27ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 2022

 Score = 46.1 bits (23), Expect = 0.012
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 122 tcttcctcctcctccccctcctc 144
           |||||||||||||||||||||||
Sbjct: 149 tcttcctcctcctccccctcctc 171
>gb|BH236132.1|BH236132 ATZKD96TR ATZK Arabidopsis thaliana genomic clone ATZKD96, DNA
           sequence
          Length = 681

 Score = 44.1 bits (22), Expect = 0.049
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 123 cttcctcctcctccccctcctc 144
           ||||||||||||||||||||||
Sbjct: 167 cttcctcctcctccccctcctc 188
>gb|BT004312.1| Arabidopsis thaliana clone RAFL16-03-D02 (R50144) unknown protein
            (At5g03670) mRNA, complete cds
          Length = 2016

 Score = 44.1 bits (22), Expect = 0.049
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 119  tcttcttcctcctcctccccctcctc 144
            |||||||||||||||||| |||||||
Sbjct: 1337 tcttcttcctcctcctcctcctcctc 1312
>gb|BT005624.1| Arabidopsis thaliana clone U50144 unknown protein (At5g03670) mRNA,
            complete cds
          Length = 1582

 Score = 44.1 bits (22), Expect = 0.049
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 119  tcttcttcctcctcctccccctcctc 144
            |||||||||||||||||| |||||||
Sbjct: 1172 tcttcttcctcctcctcctcctcctc 1147
>emb|BX831345.1|CNS09YRH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS7ZF12 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1839

 Score = 44.1 bits (22), Expect = 0.049
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 119  tcttcttcctcctcctccccctcctc 144
            |||||||||||||||||| |||||||
Sbjct: 1317 tcttcttcctcctcctcctcctcctc 1292
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
          Length = 23810767

 Score = 44.1 bits (22), Expect = 0.049
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 119    tcttcttcctcctcctccccctcctc 144
              |||||||||||||||||| |||||||
Sbjct: 949075 tcttcttcctcctcctcctcctcctc 949050
>emb|AL162506.1|ATF17C15 Arabidopsis thaliana DNA chromosome 5, BAC clone F17C15 (ESSA project)
          Length = 102897

 Score = 44.1 bits (22), Expect = 0.049
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 119   tcttcttcctcctcctccccctcctc 144
             |||||||||||||||||| |||||||
Sbjct: 44778 tcttcttcctcctcctcctcctcctc 44753
>ref|NM_120448.2| Arabidopsis thaliana unknown protein AT5G03670 mRNA, complete cds
          Length = 1989

 Score = 44.1 bits (22), Expect = 0.049
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 119  tcttcttcctcctcctccccctcctc 144
            |||||||||||||||||| |||||||
Sbjct: 1337 tcttcttcctcctcctcctcctcctc 1312
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
          Length = 26992728

 Score = 44.1 bits (22), Expect = 0.049
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 119    tcttcttcctcctcctccccctcctc 144
              |||||||||||||||||| |||||||
Sbjct: 949518 tcttcttcctcctcctcctcctcctc 949493
>gb|B19307.1|B19307 F1F22-T7 IGF Arabidopsis thaliana genomic clone F1F22, DNA sequence
          Length = 784

 Score = 42.1 bits (21), Expect = 0.19
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 118 ctcttcttcctcctcctccccctcc 142
           |||||| ||||||||||||||||||
Sbjct: 734 ctcttcctcctcctcctccccctcc 758
>gb|BP827278.1|BP827278 BP827278 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-75-A02 5',
           mRNA sequence
          Length = 398

 Score = 42.1 bits (21), Expect = 0.19
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 122 tcttcctcctcctccccctcctcac 146
           ||||||||||||||| |||||||||
Sbjct: 149 tcttcctcctcctcctcctcctcac 173
>emb|BX827391.1|CNS0A2DD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS4ZD10 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1377

 Score = 42.1 bits (21), Expect = 0.19
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 112  ctcctgctcttcttcctcctcctcc 136
            ||||| |||||||||||||||||||
Sbjct: 1073 ctcctcctcttcttcctcctcctcc 1049
  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 501,349
Number of Sequences: 1013581
Number of extensions: 501349
Number of successful extensions: 48943
Number of sequences better than  0.5: 12
Number of HSP's better than  0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48441
Number of HSP's gapped (non-prelim): 492
length of query: 1061
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1041
effective length of database: 888,669,252
effective search space: 925104691332
effective search space used: 925104691332
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)