BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2493528.2.1
(627 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|BX831519.1|CNS0A0W1 Arabidopsis thaliana Full-length cD... 50 5e-004
emb|BX832407.1|CNS0A0ZV Arabidopsis thaliana Full-length cD... 50 5e-004
dbj|AP002032.1| Arabidopsis thaliana genomic DNA, chromosom... 50 5e-004
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 50 5e-004
ref|NM_120766.3| Arabidopsis thaliana unknown protein AT5G0... 50 5e-004
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 50 5e-004
gb|CB259351.1|CB259351 58-E9537-013-002-C16-T7R MPIZ-ADIS-0... 42 0.11
gb|CB259439.1|CB259439 50-E9537-013-002-C14-T7R MPIZ-ADIS-0... 42 0.11
>emb|BX831519.1|CNS0A0W1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH12ZB08 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1792
Score = 50.1 bits (25), Expect = 5e-004
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 91 gtattgatctctccaattatatacactggtcttccatcaaa 131
|||||||||||||| |||||| ||| ||||||||||||||
Sbjct: 1676 gtattgatctctcctcttatattcacaggtcttccatcaaa 1636
Score = 42.1 bits (21), Expect = 0.11
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 544 aaatcatccagaatattattcctatattctttctcca 580
|||||||| || || ||||||||||||||| ||||||
Sbjct: 1223 aaatcatcaaggatcttattcctatattctgtctcca 1187
>emb|BX832407.1|CNS0A0ZV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH70ZF08 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1819
Score = 50.1 bits (25), Expect = 5e-004
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 91 gtattgatctctccaattatatacactggtcttccatcaaa 131
|||||||||||||| |||||| ||| ||||||||||||||
Sbjct: 1692 gtattgatctctcctcttatattcacaggtcttccatcaaa 1652
>dbj|AP002032.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPH15
Length = 71277
Score = 50.1 bits (25), Expect = 5e-004
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 91 gtattgatctctccaattatatacactggtcttccatcaaa 131
|||||||||||||| |||||| ||| ||||||||||||||
Sbjct: 67163 gtattgatctctcctcttatattcacaggtcttccatcaaa 67203
Score = 42.1 bits (21), Expect = 0.11
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 544 aaatcatccagaatattattcctatattctttctcca 580
|||||||| || || ||||||||||||||| ||||||
Sbjct: 67894 aaatcatcaaggatcttattcctatattctgtctcca 67930
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 50.1 bits (25), Expect = 5e-004
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 91 gtattgatctctccaattatatacactggtcttccatcaaa 131
|||||||||||||| |||||| ||| ||||||||||||||
Sbjct: 1955948 gtattgatctctcctcttatattcacaggtcttccatcaaa 1955988
Score = 42.1 bits (21), Expect = 0.11
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 544 aaatcatccagaatattattcctatattctttctcca 580
|||||||| || || ||||||||||||||| ||||||
Sbjct: 1956679 aaatcatcaaggatcttattcctatattctgtctcca 1956715
>ref|NM_120766.3| Arabidopsis thaliana unknown protein AT5G06830 mRNA, complete cds
Length = 1819
Score = 50.1 bits (25), Expect = 5e-004
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 91 gtattgatctctccaattatatacactggtcttccatcaaa 131
|||||||||||||| |||||| ||| ||||||||||||||
Sbjct: 1692 gtattgatctctcctcttatattcacaggtcttccatcaaa 1652
Score = 42.1 bits (21), Expect = 0.11
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 544 aaatcatccagaatattattcctatattctttctcca 580
|||||||| || || ||||||||||||||| ||||||
Sbjct: 1239 aaatcatcaaggatcttattcctatattctgtctcca 1203
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 50.1 bits (25), Expect = 5e-004
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 91 gtattgatctctccaattatatacactggtcttccatcaaa 131
|||||||||||||| |||||| ||| ||||||||||||||
Sbjct: 2116911 gtattgatctctcctcttatattcacaggtcttccatcaaa 2116951
Score = 42.1 bits (21), Expect = 0.11
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 544 aaatcatccagaatattattcctatattctttctcca 580
|||||||| || || ||||||||||||||| ||||||
Sbjct: 2117642 aaatcatcaaggatcttattcctatattctgtctcca 2117678
>gb|CB259351.1|CB259351 58-E9537-013-002-C16-T7R MPIZ-ADIS-013 Arabidopsis thaliana cDNA
clone MPIZp770C162Q 5-PRIME, mRNA sequence
Length = 579
Score = 42.1 bits (21), Expect = 0.11
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 544 aaatcatccagaatattattcctatattctttctcca 580
|||||||| || || ||||||||||||||| ||||||
Sbjct: 289 aaatcatcaaggatcttattcctatattctgtctcca 253
>gb|CB259439.1|CB259439 50-E9537-013-002-C14-T7R MPIZ-ADIS-013 Arabidopsis thaliana cDNA
clone MPIZp770C142Q 5-PRIME, mRNA sequence
Length = 658
Score = 42.1 bits (21), Expect = 0.11
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 544 aaatcatccagaatattattcctatattctttctcca 580
|||||||| || || ||||||||||||||| ||||||
Sbjct: 290 aaatcatcaaggatcttattcctatattctgtctcca 254
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 416,286
Number of Sequences: 1013581
Number of extensions: 416286
Number of successful extensions: 31858
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31500
Number of HSP's gapped (non-prelim): 358
length of query: 627
length of database: 908,940,872
effective HSP length: 20
effective length of query: 607
effective length of database: 888,669,252
effective search space: 539422235964
effective search space used: 539422235964
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)