BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2478337.2.1
(729 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BH613541.1|BH613541 SALK_034428 Arabidopsis thaliana TDN... 42 0.13
gb|BH748284.1|BH748284 SALK_045088.45.55.x Arabidopsis thal... 42 0.13
emb|BX654758.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.13
gb|BP823531.1|BP823531 BP823531 RAFL19 Arabidopsis thaliana... 42 0.13
gb|BP835558.1|BP835558 BP835558 RAFL19 Arabidopsis thaliana... 42 0.13
gb|BP842164.1|BP842164 BP842164 RAFL21 Arabidopsis thaliana... 42 0.13
gb|AC022520.2|AC022520 Arabidopsis thaliana chromosome I BA... 42 0.13
gb|AC019018.9|AC019018 Arabidopsis thaliana chromosome 1 BA... 42 0.13
dbj|AB013395.1| Arabidopsis thaliana genomic DNA, chromosom... 42 0.13
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 42 0.13
emb|AJ505021.1|ATH505021 Arabidopsis thaliana mRNA for puta... 42 0.13
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 42 0.13
ref|NM_104178.3| Arabidopsis thaliana 3-deoxy-manno-octulos... 42 0.13
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 42 0.13
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 42 0.13
>gb|BH613541.1|BH613541 SALK_034428 Arabidopsis thaliana TDNA insertion lines Arabidopsis
thaliana genomic clone SALK_034428, DNA sequence
Length = 135
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 304 tttcttcttcttctcagaaaa 324
|||||||||||||||||||||
Sbjct: 55 tttcttcttcttctcagaaaa 75
>gb|BH748284.1|BH748284 SALK_045088.45.55.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_045088.45.55.x,
DNA sequence
Length = 292
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 304 tttcttcttcttctcagaaaa 324
|||||||||||||||||||||
Sbjct: 72 tttcttcttcttctcagaaaa 92
>emb|BX654758.1| Arabidopsis thaliana T-DNA flanking sequence GK-583C02-021755,
genomic survey sequence
Length = 178
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 297 catacattttcttcttcttct 317
|||||||||||||||||||||
Sbjct: 51 catacattttcttcttcttct 71
>gb|BP823531.1|BP823531 BP823531 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-65-H06 5',
mRNA sequence
Length = 371
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 306 tcttcttcttctcagaaaaca 326
|||||||||||||||||||||
Sbjct: 42 tcttcttcttctcagaaaaca 62
>gb|BP835558.1|BP835558 BP835558 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-13-M01 5',
mRNA sequence
Length = 387
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 306 tcttcttcttctcagaaaaca 326
|||||||||||||||||||||
Sbjct: 43 tcttcttcttctcagaaaaca 63
>gb|BP842164.1|BP842164 BP842164 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-53-L20 5',
mRNA sequence
Length = 386
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 306 tcttcttcttctcagaaaaca 326
|||||||||||||||||||||
Sbjct: 132 tcttcttcttctcagaaaaca 152
>gb|AC022520.2|AC022520 Arabidopsis thaliana chromosome I BAC F8L10 genomic sequence, complete
sequence
Length = 110611
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 306 tcttcttcttctcagaaaaca 326
|||||||||||||||||||||
Sbjct: 78826 tcttcttcttctcagaaaaca 78846
>gb|AC019018.9|AC019018 Arabidopsis thaliana chromosome 1 BAC F14G24 genomic sequence, complete
sequence
Length = 126253
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 306 tcttcttcttctcagaaaaca 326
|||||||||||||||||||||
Sbjct: 116177 tcttcttcttctcagaaaaca 116157
>dbj|AB013395.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQN23
Length = 86064
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 304 tttcttcttcttctcagaaaa 324
|||||||||||||||||||||
Sbjct: 47929 tttcttcttcttctcagaaaa 47909
>dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, complete sequence
Length = 23810767
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 304 tttcttcttcttctcagaaaa 324
|||||||||||||||||||||
Sbjct: 23045279 tttcttcttcttctcagaaaa 23045259
>emb|AJ505021.1|ATH505021 Arabidopsis thaliana mRNA for putative CMP-KDO synthetase (kdo1
gene)
Length = 873
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 306 tcttcttcttctcagaaaaca 326
|||||||||||||||||||||
Sbjct: 19 tcttcttcttctcagaaaaca 39
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 306 tcttcttcttctcagaaaaca 326
|||||||||||||||||||||
Sbjct: 4106378 tcttcttcttctcagaaaaca 4106358
>ref|NM_104178.3| Arabidopsis thaliana 3-deoxy-manno-octulosonate
cytidylyltransferase/ nucleotidyltransferase AT1G53000
mRNA, complete cds
Length = 1149
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 306 tcttcttcttctcagaaaaca 326
|||||||||||||||||||||
Sbjct: 19 tcttcttcttctcagaaaaca 39
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 304 tttcttcttcttctcagaaaa 324
|||||||||||||||||||||
Sbjct: 26067192 tttcttcttcttctcagaaaa 26067172
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 42.1 bits (21), Expect = 0.13
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 306 tcttcttcttctcagaaaaca 326
|||||||||||||||||||||
Sbjct: 19750783 tcttcttcttctcagaaaaca 19750763
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 574,051
Number of Sequences: 1013581
Number of extensions: 574051
Number of successful extensions: 104636
Number of sequences better than 0.5: 15
Number of HSP's better than 0.5 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 102788
Number of HSP's gapped (non-prelim): 1848
length of query: 729
length of database: 908,940,872
effective HSP length: 20
effective length of query: 709
effective length of database: 888,669,252
effective search space: 630066499668
effective search space used: 630066499668
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)