BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2440918.2.1
(1469 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV539015.1|AV539015 AV539015 Arabidopsis thaliana roots ... 44 0.068
>gb|AV539015.1|AV539015 AV539015 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ125f04F 3', mRNA sequence
Length = 539
Score = 44.1 bits (22), Expect = 0.068
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 281 cacttccacgactgcttcgtca 302
||||||||||||||||||||||
Sbjct: 212 cacttccacgactgcttcgtca 233
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 492,400
Number of Sequences: 1013581
Number of extensions: 492400
Number of successful extensions: 36958
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36957
Number of HSP's gapped (non-prelim): 1
length of query: 1469
length of database: 908,940,872
effective HSP length: 21
effective length of query: 1448
effective length of database: 887,655,671
effective search space: 1285325411608
effective search space used: 1285325411608
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)