BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419405.2.1
(1293 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BP612852.1|BP612852 BP612852 RAFL16 Arabidopsis thaliana... 48 0.004
emb|AL082485.1|CNS00NX3 Arabidopsis thaliana genome survey ... 46 0.015
gb|CC887164.1|CC887164 SALK_149674.46.20.x Arabidopsis thal... 46 0.015
gb|CL489839.1|CL489839 SAIL_52b_F10.v1 SAIL Collection Arab... 46 0.015
gb|AU228159.1|AU228159 AU228159 RAFL16 Arabidopsis thaliana... 46 0.015
gb|AU237086.1|AU237086 AU237086 RAFL15 Arabidopsis thaliana... 46 0.015
gb|CF652441.1|CF652441 55-L020579-066-004-N13-SP6P MPIZ-ADI... 46 0.015
gb|CD530061.1|CD530061 27F19 Arabidopsis Leaf Senescence Li... 46 0.015
gb|AV522809.1|AV522809 AV522809 Arabidopsis thaliana aboveg... 46 0.015
gb|BP604229.1|BP604229 BP604229 RAFL16 Arabidopsis thaliana... 46 0.015
gb|BP609401.1|BP609401 BP609401 RAFL16 Arabidopsis thaliana... 46 0.015
gb|BP625978.1|BP625978 BP625978 RAFL17 Arabidopsis thaliana... 46 0.015
gb|BP630575.1|BP630575 BP630575 RAFL17 Arabidopsis thaliana... 46 0.015
gb|BP666960.1|BP666960 BP666960 RAFL21 Arabidopsis thaliana... 46 0.015
gb|BP783730.1|BP783730 BP783730 RAFL7 Arabidopsis thaliana ... 46 0.015
gb|BP814418.1|BP814418 BP814418 RAFL19 Arabidopsis thaliana... 46 0.015
gb|BP817314.1|BP817314 BP817314 RAFL19 Arabidopsis thaliana... 46 0.015
gb|BP819373.1|BP819373 BP819373 RAFL19 Arabidopsis thaliana... 46 0.015
gb|BP825850.1|BP825850 BP825850 RAFL19 Arabidopsis thaliana... 46 0.015
gb|BP828463.1|BP828463 BP828463 RAFL19 Arabidopsis thaliana... 46 0.015
gb|BP836564.1|BP836564 BP836564 RAFL19 Arabidopsis thaliana... 46 0.015
gb|BP852085.1|BP852085 BP852085 RAFL21 Arabidopsis thaliana... 46 0.015
gb|BT004227.1| Arabidopsis thaliana clone RAFL16-01-H05 (R2... 46 0.015
gb|AY085275.1| Arabidopsis thaliana clone 14237 mRNA, compl... 46 0.015
gb|AC079675.1|AC079675 Arabidopsis thaliana chromosome 1 BA... 46 0.015
gb|AC018908.8|AC018908 Arabidopsis thaliana chromosome 1 BA... 46 0.015
gb|AC009325.8|ATAC009325 Arabidopsis thaliana chromosome II... 46 0.015
gb|AC010797.4|ATAC010797 Arabidopsis thaliana chromosome II... 46 0.015
emb|BX841885.1|CNS09Y23 Arabidopsis thaliana Full-length cD... 46 0.015
emb|BX841979.1|CNS09Y4E Arabidopsis thaliana Full-length cD... 46 0.015
emb|BX841987.1|CNS09Y5I Arabidopsis thaliana Full-length cD... 46 0.015
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 46 0.015
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 46 0.015
ref|NM_111044.2| Arabidopsis thaliana unknown protein AT3G0... 46 0.015
ref|NM_104768.2| Arabidopsis thaliana unknown protein AT1G6... 46 0.015
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 46 0.015
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 46 0.015
gb|B10243.1|B10243 T7N9-Sp6 TAMU Arabidopsis thaliana genom... 44 0.060
gb|B11891.1|B11891 T7N9-Sp6.1 TAMU Arabidopsis thaliana gen... 44 0.060
emb|AJ593627.1| Arabidopsis thaliana T-DNA flanking sequenc... 44 0.060
gb|CL488677.1|CL488677 SAIL_513_A08.v2 SAIL Collection Arab... 44 0.060
gb|CW835927.1|CW835927 ET6603.Ds3.11.04.2002.jw69.718 Arabi... 44 0.060
gb|CW838466.1|CW838466 GT5710.Ds3.01.28.00.b.566 Arabidopsi... 44 0.060
gb|AU238154.1|AU238154 AU238154 RAFL16 Arabidopsis thaliana... 44 0.060
gb|BP600309.1|BP600309 BP600309 RAFL16 Arabidopsis thaliana... 44 0.060
gb|BP858608.1|BP858608 BP858608 RAFL21 Arabidopsis thaliana... 44 0.060
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 44 0.060
gb|AY140489.1| Arabidopsis thaliana clone P2WB1-E05-996 unk... 44 0.060
gb|AY140490.1| Arabidopsis thaliana clone P2WB1-E05-970 unk... 44 0.060
gb|AY140491.1| Arabidopsis thaliana clone P2WB1-E05-1006 un... 44 0.060
gb|AY140492.1| Arabidopsis thaliana clone P2WB1-E05-1074 un... 44 0.060
gb|AY140493.1| Arabidopsis thaliana clone P2WB1-E05-1220 un... 44 0.060
gb|AY140494.1| Arabidopsis thaliana clone P2WB1-E05-1248 un... 44 0.060
gb|AY140495.1| Arabidopsis thaliana clone P2WB1-E05-6054 un... 44 0.060
gb|AY140496.1| Arabidopsis thaliana clone P2WB1-E05-6092 un... 44 0.060
gb|BT005437.1| Arabidopsis thaliana clone U50578 unknown pr... 44 0.060
gb|AC004146.1|AC004146 Arabidopsis thaliana chromosome I BA... 44 0.060
gb|AC000348.2|AC000348 Genomic sequence for Arabidopsis tha... 44 0.060
gb|AC022521.4|AC022521 Arabidopsis thaliana chromosome I BA... 44 0.060
gb|AC004557.2|AC004557 Genomic sequence for Arabidopsis tha... 44 0.060
gb|AC079285.1|AC079285 Arabidopsis thaliana chromosome 1 BA... 44 0.060
gb|AC079678.1|AC079678 Arabidopsis thaliana chromosome 1 BA... 44 0.060
gb|AC002338.3| Arabidopsis thaliana chromosome 2 clone T9D9... 44 0.060
emb|BX819685.1|CNS0AA1N Arabidopsis thaliana Full-length cD... 44 0.060
dbj|AB009052.1| Arabidopsis thaliana genomic DNA, chromosom... 44 0.060
dbj|AK117320.1| Arabidopsis thaliana At5g40630 mRNA for unk... 44 0.060
dbj|AK117472.1| Arabidopsis thaliana At2g30280 mRNA for unk... 44 0.060
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 44 0.060
ref|NM_100135.1| Arabidopsis thaliana unknown protein AT1G0... 44 0.060
ref|NM_102486.1| Arabidopsis thaliana unknown protein AT1G2... 44 0.060
ref|NM_105333.1| Arabidopsis thaliana ubiquitin-protein lig... 44 0.060
ref|NM_106078.1| Arabidopsis thaliana protein binding AT1G7... 44 0.060
ref|NM_123427.2| Arabidopsis thaliana unknown protein AT5G4... 44 0.060
ref|NM_128581.3| Arabidopsis thaliana unknown protein AT2G3... 44 0.060
ref|NM_105384.3| Arabidopsis thaliana unknown protein AT1G6... 44 0.060
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 44 0.060
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 44 0.060
gb|AF106731.1|AF106731 AF106731 Arabidopsis thaliana Col-0 ... 42 0.24
gb|BH211695.1|BH211695 SALK_006526 Arabidopsis thaliana TDN... 42 0.24
gb|BH634468.1|BH634468 SALK_045541 Arabidopsis thaliana TDN... 42 0.24
gb|BH634473.1|BH634473 SALK_045550 Arabidopsis thaliana TDN... 42 0.24
gb|BH746646.1|BH746646 SALK_045549.29.20.x Arabidopsis thal... 42 0.24
gb|BH746648.1|BH746648 SALK_045559.17.95.x Arabidopsis thal... 42 0.24
gb|BH813842.1|BH813842 SALK_065370 Arabidopsis thaliana TDN... 42 0.24
gb|CL494739.1|CL494739 SAIL_59_G04.v1 SAIL Collection Arabi... 42 0.24
emb|CR403830.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.24
gb|CW837857.1|CW837857 GT242.Ds3.01.19.00.b.520 Arabidopsis... 42 0.24
gb|Z26714.1|Z26714 ATTS1791 Strasbourg-A Arabidopsis thalia... 42 0.24
gb|AA713111.1|AA713111 32671 CD4-15 Arabidopsis thaliana cD... 42 0.24
gb|W43801.1|W43801 23194 CD4-16 Arabidopsis thaliana cDNA c... 42 0.24
gb|W43378.1|W43378 22755 CD4-15 Arabidopsis thaliana cDNA c... 42 0.24
gb|BE038302.1|BE038302 AA11G08 AA Arabidopsis thaliana cDNA... 42 0.24
gb|AU227735.1|AU227735 AU227735 RAFL15 Arabidopsis thaliana... 42 0.24
gb|AV821564.1|AV821564 AV821564 RAFL4 Arabidopsis thaliana ... 42 0.24
gb|AV823714.1|AV823714 AV823714 RAFL6 Arabidopsis thaliana ... 42 0.24
gb|AV827082.1|AV827082 AV827082 RAFL9 Arabidopsis thaliana ... 42 0.24
gb|AU236517.1|AU236517 AU236517 RAFL15 Arabidopsis thaliana... 42 0.24
gb|CB259259.1|CB259259 65-E011176-013-009-A17-T7R MPIZ-ADIS... 42 0.24
gb|BX837662.1|BX837662 BX837662 Arabidopsis thaliana Hormon... 42 0.24
gb|BX838648.1|BX838648 BX838648 Arabidopsis thaliana Flower... 42 0.24
gb|BX838747.1|BX838747 BX838747 Arabidopsis thaliana Flower... 42 0.24
gb|BX839939.1|BX839939 BX839939 Arabidopsis thaliana Hormon... 42 0.24
gb|BX841096.1|BX841096 BX841096 Arabidopsis thaliana Flower... 42 0.24
gb|AV529516.1|AV529516 AV529516 Arabidopsis thaliana aboveg... 42 0.24
gb|AV539290.1|AV539290 AV539290 Arabidopsis thaliana roots ... 42 0.24
gb|AV540310.1|AV540310 AV540310 Arabidopsis thaliana roots ... 42 0.24
gb|AV540517.1|AV540517 AV540517 Arabidopsis thaliana roots ... 42 0.24
gb|AV551705.1|AV551705 AV551705 Arabidopsis thaliana roots ... 42 0.24
gb|AV556928.1|AV556928 AV556928 Arabidopsis thaliana green ... 42 0.24
gb|BP560621.1|BP560621 BP560621 RAFL4 Arabidopsis thaliana ... 42 0.24
gb|BP562701.1|BP562701 BP562701 RAFL14 Arabidopsis thaliana... 42 0.24
gb|BP589442.1|BP589442 BP589442 RAFL15 Arabidopsis thaliana... 42 0.24
gb|BP811595.1|BP811595 BP811595 RAFL16 Arabidopsis thaliana... 42 0.24
gb|BP811886.1|BP811886 BP811886 RAFL19 Arabidopsis thaliana... 42 0.24
gb|BP834630.1|BP834630 BP834630 RAFL19 Arabidopsis thaliana... 42 0.24
gb|BP835682.1|BP835682 BP835682 RAFL19 Arabidopsis thaliana... 42 0.24
gb|BP843168.1|BP843168 BP843168 RAFL21 Arabidopsis thaliana... 42 0.24
gb|BP849772.1|BP849772 BP849772 RAFL21 Arabidopsis thaliana... 42 0.24
gb|BP859537.1|BP859537 BP859537 RAFL21 Arabidopsis thaliana... 42 0.24
gb|BP865954.1|BP865954 BP865954 RAFL21 Arabidopsis thaliana... 42 0.24
gb|DN604560.1|DN604560 JCAt5g60120 Arabidopsis Gateway cDNA... 42 0.24
gb|DR749808.1|DR749808 90-L022530-065-010-B12-SeLB MPIZ-ADI... 42 0.24
gb|AF013294.1|TM018A10 Arabidopsis thaliana BAC TM018A10 42 0.24
gb|AF296837.1|F7K24 Arabidopsis thaliana BAC F7K24 42 0.24
emb|AJ252204.1|ATH252204 Arabidopsis thaliana mRNA for NIMI... 42 0.24
gb|AY048246.1| Arabidopsis thaliana At1g02660/T14P4_9 mRNA,... 42 0.24
gb|AF418310.1|AF418310 Arabidopsis thaliana WRKY transcript... 42 0.24
gb|AY065159.1| Arabidopsis thaliana putative elongation fac... 42 0.24
gb|AF367357.1| Arabidopsis thaliana AT4g00830/A_TM018A10_14... 42 0.24
gb|AY081568.1| Arabidopsis thaliana putative elongation fac... 42 0.24
gb|AY113171.1| Arabidopsis thaliana AT4g00830/A_TM018A10_14... 42 0.24
gb|AF214560.1| Arabidopsis thaliana RAN GTPase activating p... 42 0.24
gb|AY139797.1| Arabidopsis thaliana At1g02660/T14P4_9 mRNA,... 42 0.24
gb|AF370259.1| Arabidopsis thaliana unknown protein (At5g27... 42 0.24
gb|AY063075.1| Arabidopsis thaliana unknown protein (At5g27... 42 0.24
gb|AY074373.1| Arabidopsis thaliana At5g60120 mRNA sequence 42 0.24
emb|AX510122.1| Sequence 4817 from Patent WO0216655 42 0.24
gb|BT001916.1| Arabidopsis thaliana clone C105157 putative ... 42 0.24
gb|BT004066.1| Arabidopsis thaliana clone RAFL15-20-P05 (R2... 42 0.24
gb|AY140488.1| Arabidopsis thaliana clone P2WB1-E05-903 unk... 42 0.24
gb|AY140497.1| Arabidopsis thaliana clone P2WB1-E05-6094 un... 42 0.24
gb|AY087429.1| Arabidopsis thaliana clone 35337 mRNA, compl... 42 0.24
emb|BX323472.1| Arabidopsis thaliana transposon insertion S... 42 0.24
gb|AC007478.1|AC007478 Arabidopsis thaliana BAC F15A18 from... 42 0.24
gb|AC023754.3|AC023754 Arabidopsis thaliana chromosome I BA... 42 0.24
gb|AC002560.2|AC002560 Genomic sequence for Arabidopsis tha... 42 0.24
gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K... 42 0.24
gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D2... 42 0.24
emb|BX841533.1|CNS09YG2 Arabidopsis thaliana Full-length cD... 42 0.24
emb|BX842001.1|CNS09Y84 Arabidopsis thaliana Full-length cD... 42 0.24
emb|BX831753.1|CNS09ZVV Arabidopsis thaliana Full-length cD... 42 0.24
emb|BX820611.1|CNS0A8PL Arabidopsis thaliana Full-length cD... 42 0.24
emb|BX820727.1|CNS0A8QL Arabidopsis thaliana Full-length cD... 42 0.24
emb|BX820768.1|CNS0A8OK Arabidopsis thaliana Full-length cD... 42 0.24
emb|BX814082.1|CNS0AC06 Arabidopsis thaliana Full-length cD... 42 0.24
emb|BX814095.1|CNS0AC54 Arabidopsis thaliana Full-length cD... 42 0.24
emb|BX814993.1|CNS0ACT8 Arabidopsis thaliana Full-length cD... 42 0.24
emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, shor... 42 0.24
dbj|AB009051.1| Arabidopsis thaliana genomic DNA, chromosom... 42 0.24
dbj|AB009055.1| Arabidopsis thaliana genomic DNA, chromosom... 42 0.24
dbj|AB019231.1| Arabidopsis thaliana genomic DNA, chromosom... 42 0.24
emb|CQ803864.1| Sequence 275 from Patent WO2004035798 42 0.24
gb|AY630781.1| Arabidopsis thaliana hypothetical protein (A... 42 0.24
gb|AY630782.1| Arabidopsis thaliana hypothetical protein (A... 42 0.24
emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome... 42 0.24
emb|AL161493.2|ATCHRIV5 Arabidopsis thaliana DNA chromosome... 42 0.24
emb|AL163832.1|ATF27K19 Arabidopsis thaliana DNA chromosome... 42 0.24
gb|AC007138.1| Arabidopsis thaliana BAC T7B11 from chromoso... 42 0.24
ref|NM_127367.1| Arabidopsis thaliana translation elongatio... 42 0.24
ref|NM_124661.1| Arabidopsis thaliana WRKY27; transcription... 42 0.24
ref|NM_100146.2| Arabidopsis thaliana triacylglycerol lipas... 42 0.24
ref|NM_100226.2| Arabidopsis thaliana protein binding AT1G0... 42 0.24
ref|NM_116309.2| Arabidopsis thaliana RNA binding / nucleic... 42 0.24
ref|NM_116420.2| Arabidopsis thaliana unknown protein AT4G0... 42 0.24
ref|NM_178953.1| Arabidopsis thaliana unknown protein AT4G0... 42 0.24
ref|NM_122638.2| Arabidopsis thaliana unknown protein AT5G2... 42 0.24
ref|NM_125405.3| Arabidopsis thaliana TOE2; DNA binding / t... 42 0.24
ref|NM_121937.3| Arabidopsis thaliana RANGAP2 (RAN GTPASE A... 42 0.24
ref|NM_001036489.1| Arabidopsis thaliana RNA binding / nucl... 42 0.24
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 42 0.24
>gb|BP612852.1|BP612852 BP612852 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-91-B02 3',
mRNA sequence
Length = 373
Score = 48.1 bits (24), Expect = 0.004
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 1208 catcatcatcttcttcttctccat 1231
||||||||||||||||||||||||
Sbjct: 280 catcatcatcttcttcttctccat 303
>emb|AL082485.1|CNS00NX3 Arabidopsis thaliana genome survey sequence T7 end of BAC F4P13 of
IGF library from strain Columbia of Arabidopsis thaliana,
genomic survey sequence
Length = 376
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 340 tcatcatcatcttcttcttctcc 362
>gb|CC887164.1|CC887164 SALK_149674.46.20.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_149674.46.20.x,
DNA sequence
Length = 346
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 188 atcatcatcttcttcttctccat 210
>gb|CL489839.1|CL489839 SAIL_52b_F10.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_52b_F10.v1, DNA sequence
Length = 912
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 522 tcatcatcatcttcttcttctcc 544
>gb|AU228159.1|AU228159 AU228159 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-01-H05 3',
mRNA sequence
Length = 404
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 45 tcatcatcatcttcttcttctcc 67
>gb|AU237086.1|AU237086 AU237086 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-47-J07 5',
mRNA sequence
Length = 612
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 543 atcatcatcttcttcttctccat 521
>gb|CF652441.1|CF652441 55-L020579-066-004-N13-SP6P MPIZ-ADIS-066 Arabidopsis thaliana cDNA
clone MPIZp2001N134Q 5-PRIME, mRNA sequence
Length = 731
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 13 atcatcatcttcttcttctccat 35
>gb|CD530061.1|CD530061 27F19 Arabidopsis Leaf Senescence Library Arabidopsis thaliana cDNA
3', mRNA sequence
Length = 252
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 79 tcatcatcatcttcttcttctcc 57
>gb|AV522809.1|AV522809 AV522809 Arabidopsis thaliana aboveground organs two to six-week old
Arabidopsis thaliana cDNA clone APZL06h09F 3', mRNA
sequence
Length = 617
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 284 tcatcatcatcttcttcttctcc 306
>gb|BP604229.1|BP604229 BP604229 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-61-M17 3',
mRNA sequence
Length = 388
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 7 tcatcatcatcttcttcttctcc 29
>gb|BP609401.1|BP609401 BP609401 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-82-A01 3',
mRNA sequence
Length = 460
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 7 tcatcatcatcttcttcttctcc 29
>gb|BP625978.1|BP625978 BP625978 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-45-M05 3',
mRNA sequence
Length = 437
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 160 atcatcatcttcttcttctccat 182
>gb|BP630575.1|BP630575 BP630575 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-20-K02 3',
mRNA sequence
Length = 418
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 159 atcatcatcttcttcttctccat 181
>gb|BP666960.1|BP666960 BP666960 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-21-J02 3',
mRNA sequence
Length = 440
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 198 atcatcatcttcttcttctccat 220
>gb|BP783730.1|BP783730 BP783730 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-87-N11 3', mRNA
sequence
Length = 412
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 328 tcatcatcatcttcttcttctcc 350
>gb|BP814418.1|BP814418 BP814418 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-35-K04 5',
mRNA sequence
Length = 376
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 24 atcatcatcttcttcttctccat 46
>gb|BP817314.1|BP817314 BP817314 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-44-J06 5',
mRNA sequence
Length = 404
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 66 atcatcatcttcttcttctccat 88
>gb|BP819373.1|BP819373 BP819373 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-51-B07 5',
mRNA sequence
Length = 406
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 66 atcatcatcttcttcttctccat 88
>gb|BP825850.1|BP825850 BP825850 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-69-P06 5',
mRNA sequence
Length = 375
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 64 atcatcatcttcttcttctccat 86
>gb|BP828463.1|BP828463 BP828463 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-78-P05 5',
mRNA sequence
Length = 373
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 64 atcatcatcttcttcttctccat 86
>gb|BP836564.1|BP836564 BP836564 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-16-N02 5',
mRNA sequence
Length = 396
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 66 atcatcatcttcttcttctccat 88
>gb|BP852085.1|BP852085 BP852085 RAFL21 Arabidopsis thaliana cDNA clone RAFL25-18-K20 5',
mRNA sequence
Length = 364
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 29 atcatcatcttcttcttctccat 51
>gb|BT004227.1| Arabidopsis thaliana clone RAFL16-01-H05 (R20885) unknown protein
(At3g01780) mRNA, partial cds
Length = 3517
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 3455 tcatcatcatcttcttcttctcc 3433
>gb|AY085275.1| Arabidopsis thaliana clone 14237 mRNA, complete sequence
Length = 624
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 30 atcatcatcttcttcttctccat 52
>gb|AC079675.1|AC079675 Arabidopsis thaliana chromosome 1 BAC F23C21 genomic sequence,
complete sequence
Length = 20264
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 1077 atcatcatcttcttcttctccat 1055
>gb|AC018908.8|AC018908 Arabidopsis thaliana chromosome 1 BAC T7P1 genomic sequence, complete
sequence
Length = 102299
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 4758 atcatcatcttcttcttctccat 4780
>gb|AC009325.8|ATAC009325 Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence, complete
sequence
Length = 105543
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 105203 tcatcatcatcttcttcttctcc 105181
>gb|AC010797.4|ATAC010797 Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence,
complete sequence
Length = 89154
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 27909 tcatcatcatcttcttcttctcc 27887
>emb|BX841885.1|CNS09Y23 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL11ZH10 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 933
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 20 atcatcatcttcttcttctccat 42
>emb|BX841979.1|CNS09Y4E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL88ZB02 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 725
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 19 atcatcatcttcttcttctccat 41
>emb|BX841987.1|CNS09Y5I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL95ZG09 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 619
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 13 atcatcatcttcttcttctccat 35
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 283221 tcatcatcatcttcttcttctcc 283199
Score = 42.1 bits (21), Expect = 0.24
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttc 1226
|||||||||||||||||||||
Sbjct: 20692407 atcatcatcatcttcttcttc 20692427
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 6650989 atcatcatcttcttcttctccat 6651011
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 12138681 atcatcatcatcttcttcttct 12138702
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 9342930 atcatcatcatcttcttcttct 9342951
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 9094168 atcatcatcatcttcttcttct 9094189
Score = 42.1 bits (21), Expect = 0.24
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1206 atcatcatcatcttcttcttc 1226
|||||||||||||||||||||
Sbjct: 12513139 atcatcatcatcttcttcttc 12513119
>ref|NM_111044.2| Arabidopsis thaliana unknown protein AT3G01780 mRNA, complete cds
Length = 3790
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 3455 tcatcatcatcttcttcttctcc 3433
>ref|NM_104768.2| Arabidopsis thaliana unknown protein AT1G60870 mRNA, complete cds
Length = 951
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 202 atcatcatcttcttcttctccat 224
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttctcc 1229
|||||||||||||||||||||||
Sbjct: 283219 tcatcatcatcttcttcttctcc 283197
Score = 42.1 bits (21), Expect = 0.24
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttc 1226
|||||||||||||||||||||
Sbjct: 20739931 atcatcatcatcttcttcttc 20739951
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 46.1 bits (23), Expect = 0.015
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1209 atcatcatcttcttcttctccat 1231
|||||||||||||||||||||||
Sbjct: 22413338 atcatcatcttcttcttctccat 22413360
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 27901023 atcatcatcatcttcttcttct 27901044
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 25105279 atcatcatcatcttcttcttct 25105300
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 24856517 atcatcatcatcttcttcttct 24856538
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 9469558 atcatcatcatcttcttcttct 9469579
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 535175 atcatcatcatcttcttcttct 535196
Score = 42.1 bits (21), Expect = 0.24
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1206 atcatcatcatcttcttcttc 1226
|||||||||||||||||||||
Sbjct: 28275481 atcatcatcatcttcttcttc 28275461
Score = 42.1 bits (21), Expect = 0.24
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttct 1227
|||||||||||||||||||||
Sbjct: 852689 tcatcatcatcttcttcttct 852669
Score = 42.1 bits (21), Expect = 0.24
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttct 1227
|||||||||||||||||||||
Sbjct: 574364 tcatcatcatcttcttcttct 574384
>gb|B10243.1|B10243 T7N9-Sp6 TAMU Arabidopsis thaliana genomic clone T7N9, DNA sequence
Length = 720
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 411 atcatcatcatcttcttcttct 390
>gb|B11891.1|B11891 T7N9-Sp6.1 TAMU Arabidopsis thaliana genomic clone T7N9, DNA sequence
Length = 1206
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 368 atcatcatcatcttcttcttct 347
>emb|AJ593627.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
384F06, genomic survey sequence
Length = 50
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 27 atcatcatcatcttcttcttct 6
>gb|CL488677.1|CL488677 SAIL_513_A08.v2 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_513_A08.v2, DNA sequence
Length = 956
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 150 atcatcatcatcttcttcttct 129
>gb|CW835927.1|CW835927 ET6603.Ds3.11.04.2002.jw69.718 Arabidopsis thaliana Landsberg Ds
insertion lines Arabidopsis thaliana genomic clone
ET6603, DNA sequence
Length = 718
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 692 atcatcatcatcttcttcttct 713
>gb|CW838466.1|CW838466 GT5710.Ds3.01.28.00.b.566 Arabidopsis thaliana Landsberg Ds insertion
lines Arabidopsis thaliana genomic clone GT5710, DNA
sequence
Length = 566
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 228 atcatcatcatcttcttcttct 249
>gb|AU238154.1|AU238154 AU238154 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-88-P09 5',
mRNA sequence
Length = 603
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1205 tatcatcatcatcttcttcttc 1226
||||||||||||||||||||||
Sbjct: 177 tatcatcatcatcttcttcttc 198
>gb|BP600309.1|BP600309 BP600309 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-45-J24 3',
mRNA sequence
Length = 379
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1208 catcatcatcttcttcttctcc 1229
||||||||||||||||||||||
Sbjct: 1 catcatcatcttcttcttctcc 22
>gb|BP858608.1|BP858608 BP858608 RAFL21 Arabidopsis thaliana cDNA clone RAFL25-37-N20 5',
mRNA sequence
Length = 379
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1205 tatcatcatcatcttcttcttc 1226
||||||||||||||||||||||
Sbjct: 183 tatcatcatcatcttcttcttc 204
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 9478354 atcatcatcatcttcttcttct 9478375
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 535234 atcatcatcatcttcttcttct 535255
Score = 42.1 bits (21), Expect = 0.24
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttct 1227
|||||||||||||||||||||
Sbjct: 852752 tcatcatcatcttcttcttct 852732
Score = 42.1 bits (21), Expect = 0.24
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttct 1227
|||||||||||||||||||||
Sbjct: 574423 tcatcatcatcttcttcttct 574443
>gb|AY140489.1| Arabidopsis thaliana clone P2WB1-E05-996 unknown protein gene, exons
41 through 43 and partial cds
Length = 1482
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 965 atcatcatcatcttcttcttct 944
>gb|AY140490.1| Arabidopsis thaliana clone P2WB1-E05-970 unknown protein gene, exons
41 through 43 and partial cds
Length = 1482
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 965 atcatcatcatcttcttcttct 944
>gb|AY140491.1| Arabidopsis thaliana clone P2WB1-E05-1006 unknown protein gene, exons
41 through 43 and partial cds
Length = 1482
Score = 44.1 bits (22), Expect = 0.060
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1206 atcatcatcatcttcttcttct 1227
||||||||||||||||||||||
Sbjct: 965 atcatcatcatcttcttcttct 944
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 807,123
Number of Sequences: 1013581
Number of extensions: 807123
Number of successful extensions: 88661
Number of sequences better than 0.5: 180
Number of HSP's better than 0.5 without gapping: 194
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79290
Number of HSP's gapped (non-prelim): 9330
length of query: 1293
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1273
effective length of database: 888,669,252
effective search space: 1131275957796
effective search space used: 1131275957796
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)