BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2419405.2.1
         (1293 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BP612852.1|BP612852  BP612852 RAFL16 Arabidopsis thaliana...    48   0.004
emb|AL082485.1|CNS00NX3  Arabidopsis thaliana genome survey ...    46   0.015
gb|CC887164.1|CC887164  SALK_149674.46.20.x Arabidopsis thal...    46   0.015
gb|CL489839.1|CL489839  SAIL_52b_F10.v1 SAIL Collection Arab...    46   0.015
gb|AU228159.1|AU228159  AU228159 RAFL16 Arabidopsis thaliana...    46   0.015
gb|AU237086.1|AU237086  AU237086 RAFL15 Arabidopsis thaliana...    46   0.015
gb|CF652441.1|CF652441  55-L020579-066-004-N13-SP6P MPIZ-ADI...    46   0.015
gb|CD530061.1|CD530061  27F19 Arabidopsis Leaf Senescence Li...    46   0.015
gb|AV522809.1|AV522809  AV522809 Arabidopsis thaliana aboveg...    46   0.015
gb|BP604229.1|BP604229  BP604229 RAFL16 Arabidopsis thaliana...    46   0.015
gb|BP609401.1|BP609401  BP609401 RAFL16 Arabidopsis thaliana...    46   0.015
gb|BP625978.1|BP625978  BP625978 RAFL17 Arabidopsis thaliana...    46   0.015
gb|BP630575.1|BP630575  BP630575 RAFL17 Arabidopsis thaliana...    46   0.015
gb|BP666960.1|BP666960  BP666960 RAFL21 Arabidopsis thaliana...    46   0.015
gb|BP783730.1|BP783730  BP783730 RAFL7 Arabidopsis thaliana ...    46   0.015
gb|BP814418.1|BP814418  BP814418 RAFL19 Arabidopsis thaliana...    46   0.015
gb|BP817314.1|BP817314  BP817314 RAFL19 Arabidopsis thaliana...    46   0.015
gb|BP819373.1|BP819373  BP819373 RAFL19 Arabidopsis thaliana...    46   0.015
gb|BP825850.1|BP825850  BP825850 RAFL19 Arabidopsis thaliana...    46   0.015
gb|BP828463.1|BP828463  BP828463 RAFL19 Arabidopsis thaliana...    46   0.015
gb|BP836564.1|BP836564  BP836564 RAFL19 Arabidopsis thaliana...    46   0.015
gb|BP852085.1|BP852085  BP852085 RAFL21 Arabidopsis thaliana...    46   0.015
gb|BT004227.1|  Arabidopsis thaliana clone RAFL16-01-H05 (R2...    46   0.015
gb|AY085275.1|  Arabidopsis thaliana clone 14237 mRNA, compl...    46   0.015
gb|AC079675.1|AC079675  Arabidopsis thaliana chromosome 1 BA...    46   0.015
gb|AC018908.8|AC018908  Arabidopsis thaliana chromosome 1 BA...    46   0.015
gb|AC009325.8|ATAC009325  Arabidopsis thaliana chromosome II...    46   0.015
gb|AC010797.4|ATAC010797  Arabidopsis thaliana chromosome II...    46   0.015
emb|BX841885.1|CNS09Y23  Arabidopsis thaliana Full-length cD...    46   0.015
emb|BX841979.1|CNS09Y4E  Arabidopsis thaliana Full-length cD...    46   0.015
emb|BX841987.1|CNS09Y5I  Arabidopsis thaliana Full-length cD...    46   0.015
dbj|BA000014.8|  Arabidopsis thaliana, chromosome 3, complet...    46   0.015
gb|AE005173.1|  Arabidopsis thaliana chromosome 1, bottom ar...    46   0.015
ref|NM_111044.2|  Arabidopsis thaliana unknown protein AT3G0...    46   0.015
ref|NM_104768.2|  Arabidopsis thaliana unknown protein AT1G6...    46   0.015
ref|NC_003074.4|  Arabidopsis thaliana chromosome 3, complet...    46   0.015
ref|NC_003070.5|  Arabidopsis thaliana chromosome 1, complet...    46   0.015
gb|B10243.1|B10243  T7N9-Sp6 TAMU Arabidopsis thaliana genom...    44   0.060
gb|B11891.1|B11891  T7N9-Sp6.1 TAMU Arabidopsis thaliana gen...    44   0.060
emb|AJ593627.1|  Arabidopsis thaliana T-DNA flanking sequenc...    44   0.060
gb|CL488677.1|CL488677  SAIL_513_A08.v2 SAIL Collection Arab...    44   0.060
gb|CW835927.1|CW835927  ET6603.Ds3.11.04.2002.jw69.718 Arabi...    44   0.060
gb|CW838466.1|CW838466  GT5710.Ds3.01.28.00.b.566 Arabidopsi...    44   0.060
gb|AU238154.1|AU238154  AU238154 RAFL16 Arabidopsis thaliana...    44   0.060
gb|BP600309.1|BP600309  BP600309 RAFL16 Arabidopsis thaliana...    44   0.060
gb|BP858608.1|BP858608  BP858608 RAFL21 Arabidopsis thaliana...    44   0.060
gb|AE005172.1|  Arabidopsis thaliana chromosome 1, top arm c...    44   0.060
gb|AY140489.1|  Arabidopsis thaliana clone P2WB1-E05-996 unk...    44   0.060
gb|AY140490.1|  Arabidopsis thaliana clone P2WB1-E05-970 unk...    44   0.060
gb|AY140491.1|  Arabidopsis thaliana clone P2WB1-E05-1006 un...    44   0.060
gb|AY140492.1|  Arabidopsis thaliana clone P2WB1-E05-1074 un...    44   0.060
gb|AY140493.1|  Arabidopsis thaliana clone P2WB1-E05-1220 un...    44   0.060
gb|AY140494.1|  Arabidopsis thaliana clone P2WB1-E05-1248 un...    44   0.060
gb|AY140495.1|  Arabidopsis thaliana clone P2WB1-E05-6054 un...    44   0.060
gb|AY140496.1|  Arabidopsis thaliana clone P2WB1-E05-6092 un...    44   0.060
gb|BT005437.1|  Arabidopsis thaliana clone U50578 unknown pr...    44   0.060
gb|AC004146.1|AC004146  Arabidopsis thaliana chromosome I BA...    44   0.060
gb|AC000348.2|AC000348  Genomic sequence for Arabidopsis tha...    44   0.060
gb|AC022521.4|AC022521  Arabidopsis thaliana chromosome I BA...    44   0.060
gb|AC004557.2|AC004557  Genomic sequence for Arabidopsis tha...    44   0.060
gb|AC079285.1|AC079285  Arabidopsis thaliana chromosome 1 BA...    44   0.060
gb|AC079678.1|AC079678  Arabidopsis thaliana chromosome 1 BA...    44   0.060
gb|AC002338.3|  Arabidopsis thaliana chromosome 2 clone T9D9...    44   0.060
emb|BX819685.1|CNS0AA1N  Arabidopsis thaliana Full-length cD...    44   0.060
dbj|AB009052.1|  Arabidopsis thaliana genomic DNA, chromosom...    44   0.060
dbj|AK117320.1|  Arabidopsis thaliana At5g40630 mRNA for unk...    44   0.060
dbj|AK117472.1|  Arabidopsis thaliana At2g30280 mRNA for unk...    44   0.060
dbj|BA000015.5|  Arabidopsis thaliana DNA, chromosome 5, com...    44   0.060
ref|NM_100135.1|  Arabidopsis thaliana unknown protein AT1G0...    44   0.060
ref|NM_102486.1|  Arabidopsis thaliana unknown protein AT1G2...    44   0.060
ref|NM_105333.1|  Arabidopsis thaliana ubiquitin-protein lig...    44   0.060
ref|NM_106078.1|  Arabidopsis thaliana protein binding AT1G7...    44   0.060
ref|NM_123427.2|  Arabidopsis thaliana unknown protein AT5G4...    44   0.060
ref|NM_128581.3|  Arabidopsis thaliana unknown protein AT2G3...    44   0.060
ref|NM_105384.3|  Arabidopsis thaliana unknown protein AT1G6...    44   0.060
ref|NC_003071.3|  Arabidopsis thaliana chromosome 2, complet...    44   0.060
ref|NC_003076.4|  Arabidopsis thaliana chromosome 5, complet...    44   0.060
gb|AF106731.1|AF106731  AF106731 Arabidopsis thaliana Col-0 ...    42   0.24 
gb|BH211695.1|BH211695  SALK_006526 Arabidopsis thaliana TDN...    42   0.24 
gb|BH634468.1|BH634468  SALK_045541 Arabidopsis thaliana TDN...    42   0.24 
gb|BH634473.1|BH634473  SALK_045550 Arabidopsis thaliana TDN...    42   0.24 
gb|BH746646.1|BH746646  SALK_045549.29.20.x Arabidopsis thal...    42   0.24 
gb|BH746648.1|BH746648  SALK_045559.17.95.x Arabidopsis thal...    42   0.24 
gb|BH813842.1|BH813842  SALK_065370 Arabidopsis thaliana TDN...    42   0.24 
gb|CL494739.1|CL494739  SAIL_59_G04.v1 SAIL Collection Arabi...    42   0.24 
emb|CR403830.1|  Arabidopsis thaliana T-DNA flanking sequenc...    42   0.24 
gb|CW837857.1|CW837857  GT242.Ds3.01.19.00.b.520 Arabidopsis...    42   0.24 
gb|Z26714.1|Z26714  ATTS1791 Strasbourg-A Arabidopsis thalia...    42   0.24 
gb|AA713111.1|AA713111  32671 CD4-15 Arabidopsis thaliana cD...    42   0.24 
gb|W43801.1|W43801  23194 CD4-16 Arabidopsis thaliana cDNA c...    42   0.24 
gb|W43378.1|W43378  22755 CD4-15 Arabidopsis thaliana cDNA c...    42   0.24 
gb|BE038302.1|BE038302  AA11G08 AA Arabidopsis thaliana cDNA...    42   0.24 
gb|AU227735.1|AU227735  AU227735 RAFL15 Arabidopsis thaliana...    42   0.24 
gb|AV821564.1|AV821564  AV821564 RAFL4 Arabidopsis thaliana ...    42   0.24 
gb|AV823714.1|AV823714  AV823714 RAFL6 Arabidopsis thaliana ...    42   0.24 
gb|AV827082.1|AV827082  AV827082 RAFL9 Arabidopsis thaliana ...    42   0.24 
gb|AU236517.1|AU236517  AU236517 RAFL15 Arabidopsis thaliana...    42   0.24 
gb|CB259259.1|CB259259  65-E011176-013-009-A17-T7R MPIZ-ADIS...    42   0.24 
gb|BX837662.1|BX837662  BX837662 Arabidopsis thaliana Hormon...    42   0.24 
gb|BX838648.1|BX838648  BX838648 Arabidopsis thaliana Flower...    42   0.24 
gb|BX838747.1|BX838747  BX838747 Arabidopsis thaliana Flower...    42   0.24 
gb|BX839939.1|BX839939  BX839939 Arabidopsis thaliana Hormon...    42   0.24 
gb|BX841096.1|BX841096  BX841096 Arabidopsis thaliana Flower...    42   0.24 
gb|AV529516.1|AV529516  AV529516 Arabidopsis thaliana aboveg...    42   0.24 
gb|AV539290.1|AV539290  AV539290 Arabidopsis thaliana roots ...    42   0.24 
gb|AV540310.1|AV540310  AV540310 Arabidopsis thaliana roots ...    42   0.24 
gb|AV540517.1|AV540517  AV540517 Arabidopsis thaliana roots ...    42   0.24 
gb|AV551705.1|AV551705  AV551705 Arabidopsis thaliana roots ...    42   0.24 
gb|AV556928.1|AV556928  AV556928 Arabidopsis thaliana green ...    42   0.24 
gb|BP560621.1|BP560621  BP560621 RAFL4 Arabidopsis thaliana ...    42   0.24 
gb|BP562701.1|BP562701  BP562701 RAFL14 Arabidopsis thaliana...    42   0.24 
gb|BP589442.1|BP589442  BP589442 RAFL15 Arabidopsis thaliana...    42   0.24 
gb|BP811595.1|BP811595  BP811595 RAFL16 Arabidopsis thaliana...    42   0.24 
gb|BP811886.1|BP811886  BP811886 RAFL19 Arabidopsis thaliana...    42   0.24 
gb|BP834630.1|BP834630  BP834630 RAFL19 Arabidopsis thaliana...    42   0.24 
gb|BP835682.1|BP835682  BP835682 RAFL19 Arabidopsis thaliana...    42   0.24 
gb|BP843168.1|BP843168  BP843168 RAFL21 Arabidopsis thaliana...    42   0.24 
gb|BP849772.1|BP849772  BP849772 RAFL21 Arabidopsis thaliana...    42   0.24 
gb|BP859537.1|BP859537  BP859537 RAFL21 Arabidopsis thaliana...    42   0.24 
gb|BP865954.1|BP865954  BP865954 RAFL21 Arabidopsis thaliana...    42   0.24 
gb|DN604560.1|DN604560  JCAt5g60120 Arabidopsis Gateway cDNA...    42   0.24 
gb|DR749808.1|DR749808  90-L022530-065-010-B12-SeLB MPIZ-ADI...    42   0.24 
gb|AF013294.1|TM018A10  Arabidopsis thaliana BAC TM018A10          42   0.24 
gb|AF296837.1|F7K24  Arabidopsis thaliana BAC F7K24                42   0.24 
emb|AJ252204.1|ATH252204  Arabidopsis thaliana mRNA for NIMI...    42   0.24 
gb|AY048246.1|  Arabidopsis thaliana At1g02660/T14P4_9 mRNA,...    42   0.24 
gb|AF418310.1|AF418310  Arabidopsis thaliana WRKY transcript...    42   0.24 
gb|AY065159.1|  Arabidopsis thaliana putative elongation fac...    42   0.24 
gb|AF367357.1|  Arabidopsis thaliana AT4g00830/A_TM018A10_14...    42   0.24 
gb|AY081568.1|  Arabidopsis thaliana putative elongation fac...    42   0.24 
gb|AY113171.1|  Arabidopsis thaliana AT4g00830/A_TM018A10_14...    42   0.24 
gb|AF214560.1|  Arabidopsis thaliana RAN GTPase activating p...    42   0.24 
gb|AY139797.1|  Arabidopsis thaliana At1g02660/T14P4_9 mRNA,...    42   0.24 
gb|AF370259.1|  Arabidopsis thaliana unknown protein (At5g27...    42   0.24 
gb|AY063075.1|  Arabidopsis thaliana unknown protein (At5g27...    42   0.24 
gb|AY074373.1|  Arabidopsis thaliana At5g60120 mRNA sequence       42   0.24 
emb|AX510122.1|  Sequence 4817 from Patent WO0216655               42   0.24 
gb|BT001916.1|  Arabidopsis thaliana clone C105157 putative ...    42   0.24 
gb|BT004066.1|  Arabidopsis thaliana clone RAFL15-20-P05 (R2...    42   0.24 
gb|AY140488.1|  Arabidopsis thaliana clone P2WB1-E05-903 unk...    42   0.24 
gb|AY140497.1|  Arabidopsis thaliana clone P2WB1-E05-6094 un...    42   0.24 
gb|AY087429.1|  Arabidopsis thaliana clone 35337 mRNA, compl...    42   0.24 
emb|BX323472.1|  Arabidopsis thaliana transposon insertion S...    42   0.24 
gb|AC007478.1|AC007478  Arabidopsis thaliana BAC F15A18 from...    42   0.24 
gb|AC023754.3|AC023754  Arabidopsis thaliana chromosome I BA...    42   0.24 
gb|AC002560.2|AC002560  Genomic sequence for Arabidopsis tha...    42   0.24 
gb|AC006201.4|  Arabidopsis thaliana chromosome 2 clone T27K...    42   0.24 
gb|AC007212.7|  Arabidopsis thaliana chromosome 2 clone F8D2...    42   0.24 
emb|BX841533.1|CNS09YG2  Arabidopsis thaliana Full-length cD...    42   0.24 
emb|BX842001.1|CNS09Y84  Arabidopsis thaliana Full-length cD...    42   0.24 
emb|BX831753.1|CNS09ZVV  Arabidopsis thaliana Full-length cD...    42   0.24 
emb|BX820611.1|CNS0A8PL  Arabidopsis thaliana Full-length cD...    42   0.24 
emb|BX820727.1|CNS0A8QL  Arabidopsis thaliana Full-length cD...    42   0.24 
emb|BX820768.1|CNS0A8OK  Arabidopsis thaliana Full-length cD...    42   0.24 
emb|BX814082.1|CNS0AC06  Arabidopsis thaliana Full-length cD...    42   0.24 
emb|BX814095.1|CNS0AC54  Arabidopsis thaliana Full-length cD...    42   0.24 
emb|BX814993.1|CNS0ACT8  Arabidopsis thaliana Full-length cD...    42   0.24 
emb|AJ270058.1|  Arabidopsis thaliana DNA chromosome 4, shor...    42   0.24 
dbj|AB009051.1|  Arabidopsis thaliana genomic DNA, chromosom...    42   0.24 
dbj|AB009055.1|  Arabidopsis thaliana genomic DNA, chromosom...    42   0.24 
dbj|AB019231.1|  Arabidopsis thaliana genomic DNA, chromosom...    42   0.24 
emb|CQ803864.1|  Sequence 275 from Patent WO2004035798             42   0.24 
gb|AY630781.1|  Arabidopsis thaliana hypothetical protein (A...    42   0.24 
gb|AY630782.1|  Arabidopsis thaliana hypothetical protein (A...    42   0.24 
emb|AL161472.2|ATCHRIV2  Arabidopsis thaliana DNA chromosome...    42   0.24 
emb|AL161493.2|ATCHRIV5  Arabidopsis thaliana DNA chromosome...    42   0.24 
emb|AL163832.1|ATF27K19  Arabidopsis thaliana DNA chromosome...    42   0.24 
gb|AC007138.1|  Arabidopsis thaliana BAC T7B11 from chromoso...    42   0.24 
ref|NM_127367.1|  Arabidopsis thaliana translation elongatio...    42   0.24 
ref|NM_124661.1|  Arabidopsis thaliana WRKY27; transcription...    42   0.24 
ref|NM_100146.2|  Arabidopsis thaliana triacylglycerol lipas...    42   0.24 
ref|NM_100226.2|  Arabidopsis thaliana protein binding AT1G0...    42   0.24 
ref|NM_116309.2|  Arabidopsis thaliana RNA binding / nucleic...    42   0.24 
ref|NM_116420.2|  Arabidopsis thaliana unknown protein AT4G0...    42   0.24 
ref|NM_178953.1|  Arabidopsis thaliana unknown protein AT4G0...    42   0.24 
ref|NM_122638.2|  Arabidopsis thaliana unknown protein AT5G2...    42   0.24 
ref|NM_125405.3|  Arabidopsis thaliana TOE2; DNA binding / t...    42   0.24 
ref|NM_121937.3|  Arabidopsis thaliana RANGAP2 (RAN GTPASE A...    42   0.24 
ref|NM_001036489.1|  Arabidopsis thaliana RNA binding / nucl...    42   0.24 
ref|NC_003075.3|  Arabidopsis thaliana chromosome 4, complet...    42   0.24 
>gb|BP612852.1|BP612852 BP612852 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-91-B02 3',
            mRNA sequence
          Length = 373

 Score = 48.1 bits (24), Expect = 0.004
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 1208 catcatcatcttcttcttctccat 1231
            ||||||||||||||||||||||||
Sbjct: 280  catcatcatcttcttcttctccat 303
>emb|AL082485.1|CNS00NX3 Arabidopsis thaliana genome survey sequence T7 end of BAC F4P13 of
            IGF library from strain Columbia of Arabidopsis thaliana,
            genomic survey sequence
          Length = 376

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1207 tcatcatcatcttcttcttctcc 1229
            |||||||||||||||||||||||
Sbjct: 340  tcatcatcatcttcttcttctcc 362
>gb|CC887164.1|CC887164 SALK_149674.46.20.x Arabidopsis thaliana TDNA insertion lines
            Arabidopsis thaliana genomic clone SALK_149674.46.20.x,
            DNA sequence
          Length = 346

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 188  atcatcatcttcttcttctccat 210
>gb|CL489839.1|CL489839 SAIL_52b_F10.v1 SAIL Collection Arabidopsis thaliana genomic clone
            SAIL_52b_F10.v1, DNA sequence
          Length = 912

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1207 tcatcatcatcttcttcttctcc 1229
            |||||||||||||||||||||||
Sbjct: 522  tcatcatcatcttcttcttctcc 544
>gb|AU228159.1|AU228159 AU228159 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-01-H05 3',
            mRNA sequence
          Length = 404

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1207 tcatcatcatcttcttcttctcc 1229
            |||||||||||||||||||||||
Sbjct: 45   tcatcatcatcttcttcttctcc 67
>gb|AU237086.1|AU237086 AU237086 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-47-J07 5',
            mRNA sequence
          Length = 612

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 543  atcatcatcttcttcttctccat 521
>gb|CF652441.1|CF652441 55-L020579-066-004-N13-SP6P MPIZ-ADIS-066 Arabidopsis thaliana cDNA
            clone MPIZp2001N134Q 5-PRIME, mRNA sequence
          Length = 731

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 13   atcatcatcttcttcttctccat 35
>gb|CD530061.1|CD530061 27F19 Arabidopsis Leaf Senescence Library Arabidopsis thaliana cDNA
            3', mRNA sequence
          Length = 252

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 1207 tcatcatcatcttcttcttctcc 1229
            |||||||||||||||||||||||
Sbjct: 79   tcatcatcatcttcttcttctcc 57
>gb|AV522809.1|AV522809 AV522809 Arabidopsis thaliana aboveground organs two to six-week old
            Arabidopsis thaliana cDNA clone APZL06h09F 3', mRNA
            sequence
          Length = 617

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1207 tcatcatcatcttcttcttctcc 1229
            |||||||||||||||||||||||
Sbjct: 284  tcatcatcatcttcttcttctcc 306
>gb|BP604229.1|BP604229 BP604229 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-61-M17 3',
            mRNA sequence
          Length = 388

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1207 tcatcatcatcttcttcttctcc 1229
            |||||||||||||||||||||||
Sbjct: 7    tcatcatcatcttcttcttctcc 29
>gb|BP609401.1|BP609401 BP609401 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-82-A01 3',
            mRNA sequence
          Length = 460

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1207 tcatcatcatcttcttcttctcc 1229
            |||||||||||||||||||||||
Sbjct: 7    tcatcatcatcttcttcttctcc 29
>gb|BP625978.1|BP625978 BP625978 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-45-M05 3',
            mRNA sequence
          Length = 437

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 160  atcatcatcttcttcttctccat 182
>gb|BP630575.1|BP630575 BP630575 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-20-K02 3',
            mRNA sequence
          Length = 418

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 159  atcatcatcttcttcttctccat 181
>gb|BP666960.1|BP666960 BP666960 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-21-J02 3',
            mRNA sequence
          Length = 440

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 198  atcatcatcttcttcttctccat 220
>gb|BP783730.1|BP783730 BP783730 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-87-N11 3', mRNA
            sequence
          Length = 412

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1207 tcatcatcatcttcttcttctcc 1229
            |||||||||||||||||||||||
Sbjct: 328  tcatcatcatcttcttcttctcc 350
>gb|BP814418.1|BP814418 BP814418 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-35-K04 5',
            mRNA sequence
          Length = 376

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 24   atcatcatcttcttcttctccat 46
>gb|BP817314.1|BP817314 BP817314 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-44-J06 5',
            mRNA sequence
          Length = 404

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 66   atcatcatcttcttcttctccat 88
>gb|BP819373.1|BP819373 BP819373 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-51-B07 5',
            mRNA sequence
          Length = 406

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 66   atcatcatcttcttcttctccat 88
>gb|BP825850.1|BP825850 BP825850 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-69-P06 5',
            mRNA sequence
          Length = 375

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 64   atcatcatcttcttcttctccat 86
>gb|BP828463.1|BP828463 BP828463 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-78-P05 5',
            mRNA sequence
          Length = 373

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 64   atcatcatcttcttcttctccat 86
>gb|BP836564.1|BP836564 BP836564 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-16-N02 5',
            mRNA sequence
          Length = 396

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 66   atcatcatcttcttcttctccat 88
>gb|BP852085.1|BP852085 BP852085 RAFL21 Arabidopsis thaliana cDNA clone RAFL25-18-K20 5',
            mRNA sequence
          Length = 364

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 29   atcatcatcttcttcttctccat 51
>gb|BT004227.1| Arabidopsis thaliana clone RAFL16-01-H05 (R20885) unknown protein
            (At3g01780) mRNA, partial cds
          Length = 3517

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 1207 tcatcatcatcttcttcttctcc 1229
            |||||||||||||||||||||||
Sbjct: 3455 tcatcatcatcttcttcttctcc 3433
>gb|AY085275.1| Arabidopsis thaliana clone 14237 mRNA, complete sequence
          Length = 624

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 30   atcatcatcttcttcttctccat 52
>gb|AC079675.1|AC079675 Arabidopsis thaliana chromosome 1 BAC F23C21 genomic sequence,
            complete sequence
          Length = 20264

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 1077 atcatcatcttcttcttctccat 1055
>gb|AC018908.8|AC018908 Arabidopsis thaliana chromosome 1 BAC T7P1 genomic sequence, complete
            sequence
          Length = 102299

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 4758 atcatcatcttcttcttctccat 4780
>gb|AC009325.8|ATAC009325 Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence, complete
              sequence
          Length = 105543

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 1207   tcatcatcatcttcttcttctcc 1229
              |||||||||||||||||||||||
Sbjct: 105203 tcatcatcatcttcttcttctcc 105181
>gb|AC010797.4|ATAC010797 Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence,
             complete sequence
          Length = 89154

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1207  tcatcatcatcttcttcttctcc 1229
             |||||||||||||||||||||||
Sbjct: 27909 tcatcatcatcttcttcttctcc 27887
>emb|BX841885.1|CNS09Y23 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTSIL11ZH10 of Silique of strain col-0 of Arabidopsis
            thaliana (thale cress)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 20   atcatcatcttcttcttctccat 42
>emb|BX841979.1|CNS09Y4E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTSIL88ZB02 of Silique of strain col-0 of Arabidopsis
            thaliana (thale cress)
          Length = 725

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 19   atcatcatcttcttcttctccat 41
>emb|BX841987.1|CNS09Y5I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTSIL95ZG09 of Silique of strain col-0 of Arabidopsis
            thaliana (thale cress)
          Length = 619

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 13   atcatcatcttcttcttctccat 35
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
          Length = 23403063

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 1207   tcatcatcatcttcttcttctcc 1229
              |||||||||||||||||||||||
Sbjct: 283221 tcatcatcatcttcttcttctcc 283199

 Score = 42.1 bits (21), Expect = 0.24
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 1206     atcatcatcatcttcttcttc 1226
                |||||||||||||||||||||
Sbjct: 20692407 atcatcatcatcttcttcttc 20692427
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
          Length = 14668883

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 1209    atcatcatcttcttcttctccat 1231
               |||||||||||||||||||||||
Sbjct: 6650989 atcatcatcttcttcttctccat 6651011

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 1206     atcatcatcatcttcttcttct 1227
                ||||||||||||||||||||||
Sbjct: 12138681 atcatcatcatcttcttcttct 12138702

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 1206    atcatcatcatcttcttcttct 1227
               ||||||||||||||||||||||
Sbjct: 9342930 atcatcatcatcttcttcttct 9342951

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 1206    atcatcatcatcttcttcttct 1227
               ||||||||||||||||||||||
Sbjct: 9094168 atcatcatcatcttcttcttct 9094189

 Score = 42.1 bits (21), Expect = 0.24
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 1206     atcatcatcatcttcttcttc 1226
                |||||||||||||||||||||
Sbjct: 12513139 atcatcatcatcttcttcttc 12513119
>ref|NM_111044.2| Arabidopsis thaliana unknown protein AT3G01780 mRNA, complete cds
          Length = 3790

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 1207 tcatcatcatcttcttcttctcc 1229
            |||||||||||||||||||||||
Sbjct: 3455 tcatcatcatcttcttcttctcc 3433
>ref|NM_104768.2| Arabidopsis thaliana unknown protein AT1G60870 mRNA, complete cds
          Length = 951

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1209 atcatcatcttcttcttctccat 1231
            |||||||||||||||||||||||
Sbjct: 202  atcatcatcttcttcttctccat 224
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
          Length = 23470805

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 1207   tcatcatcatcttcttcttctcc 1229
              |||||||||||||||||||||||
Sbjct: 283219 tcatcatcatcttcttcttctcc 283197

 Score = 42.1 bits (21), Expect = 0.24
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 1206     atcatcatcatcttcttcttc 1226
                |||||||||||||||||||||
Sbjct: 20739931 atcatcatcatcttcttcttc 20739951
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
          Length = 30432563

 Score = 46.1 bits (23), Expect = 0.015
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 1209     atcatcatcttcttcttctccat 1231
                |||||||||||||||||||||||
Sbjct: 22413338 atcatcatcttcttcttctccat 22413360

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 1206     atcatcatcatcttcttcttct 1227
                ||||||||||||||||||||||
Sbjct: 27901023 atcatcatcatcttcttcttct 27901044

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 1206     atcatcatcatcttcttcttct 1227
                ||||||||||||||||||||||
Sbjct: 25105279 atcatcatcatcttcttcttct 25105300

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 1206     atcatcatcatcttcttcttct 1227
                ||||||||||||||||||||||
Sbjct: 24856517 atcatcatcatcttcttcttct 24856538

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 1206    atcatcatcatcttcttcttct 1227
               ||||||||||||||||||||||
Sbjct: 9469558 atcatcatcatcttcttcttct 9469579

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 1206   atcatcatcatcttcttcttct 1227
              ||||||||||||||||||||||
Sbjct: 535175 atcatcatcatcttcttcttct 535196

 Score = 42.1 bits (21), Expect = 0.24
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 1206     atcatcatcatcttcttcttc 1226
                |||||||||||||||||||||
Sbjct: 28275481 atcatcatcatcttcttcttc 28275461

 Score = 42.1 bits (21), Expect = 0.24
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1207   tcatcatcatcttcttcttct 1227
              |||||||||||||||||||||
Sbjct: 852689 tcatcatcatcttcttcttct 852669

 Score = 42.1 bits (21), Expect = 0.24
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1207   tcatcatcatcttcttcttct 1227
              |||||||||||||||||||||
Sbjct: 574364 tcatcatcatcttcttcttct 574384
>gb|B10243.1|B10243 T7N9-Sp6 TAMU Arabidopsis thaliana genomic clone T7N9, DNA sequence
          Length = 720

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1206 atcatcatcatcttcttcttct 1227
            ||||||||||||||||||||||
Sbjct: 411  atcatcatcatcttcttcttct 390
>gb|B11891.1|B11891 T7N9-Sp6.1 TAMU Arabidopsis thaliana genomic clone T7N9, DNA sequence
          Length = 1206

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1206 atcatcatcatcttcttcttct 1227
            ||||||||||||||||||||||
Sbjct: 368  atcatcatcatcttcttcttct 347
>emb|AJ593627.1| Arabidopsis thaliana T-DNA flanking sequence, left border, clone
            384F06, genomic survey sequence
          Length = 50

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1206 atcatcatcatcttcttcttct 1227
            ||||||||||||||||||||||
Sbjct: 27   atcatcatcatcttcttcttct 6
>gb|CL488677.1|CL488677 SAIL_513_A08.v2 SAIL Collection Arabidopsis thaliana genomic clone
            SAIL_513_A08.v2, DNA sequence
          Length = 956

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1206 atcatcatcatcttcttcttct 1227
            ||||||||||||||||||||||
Sbjct: 150  atcatcatcatcttcttcttct 129
>gb|CW835927.1|CW835927 ET6603.Ds3.11.04.2002.jw69.718 Arabidopsis thaliana Landsberg Ds
            insertion lines Arabidopsis thaliana genomic clone
            ET6603, DNA sequence
          Length = 718

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1206 atcatcatcatcttcttcttct 1227
            ||||||||||||||||||||||
Sbjct: 692  atcatcatcatcttcttcttct 713
>gb|CW838466.1|CW838466 GT5710.Ds3.01.28.00.b.566 Arabidopsis thaliana Landsberg Ds insertion
            lines Arabidopsis thaliana genomic clone GT5710, DNA
            sequence
          Length = 566

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1206 atcatcatcatcttcttcttct 1227
            ||||||||||||||||||||||
Sbjct: 228  atcatcatcatcttcttcttct 249
>gb|AU238154.1|AU238154 AU238154 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-88-P09 5',
            mRNA sequence
          Length = 603

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1205 tatcatcatcatcttcttcttc 1226
            ||||||||||||||||||||||
Sbjct: 177  tatcatcatcatcttcttcttc 198
>gb|BP600309.1|BP600309 BP600309 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-45-J24 3',
            mRNA sequence
          Length = 379

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1208 catcatcatcttcttcttctcc 1229
            ||||||||||||||||||||||
Sbjct: 1    catcatcatcttcttcttctcc 22
>gb|BP858608.1|BP858608 BP858608 RAFL21 Arabidopsis thaliana cDNA clone RAFL25-37-N20 5',
            mRNA sequence
          Length = 379

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1205 tatcatcatcatcttcttcttc 1226
            ||||||||||||||||||||||
Sbjct: 183  tatcatcatcatcttcttcttc 204
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
          Length = 14221815

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 1206    atcatcatcatcttcttcttct 1227
               ||||||||||||||||||||||
Sbjct: 9478354 atcatcatcatcttcttcttct 9478375

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 1206   atcatcatcatcttcttcttct 1227
              ||||||||||||||||||||||
Sbjct: 535234 atcatcatcatcttcttcttct 535255

 Score = 42.1 bits (21), Expect = 0.24
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1207   tcatcatcatcttcttcttct 1227
              |||||||||||||||||||||
Sbjct: 852752 tcatcatcatcttcttcttct 852732

 Score = 42.1 bits (21), Expect = 0.24
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1207   tcatcatcatcttcttcttct 1227
              |||||||||||||||||||||
Sbjct: 574423 tcatcatcatcttcttcttct 574443
>gb|AY140489.1| Arabidopsis thaliana clone P2WB1-E05-996 unknown protein gene, exons
            41 through 43 and partial cds
          Length = 1482

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1206 atcatcatcatcttcttcttct 1227
            ||||||||||||||||||||||
Sbjct: 965  atcatcatcatcttcttcttct 944
>gb|AY140490.1| Arabidopsis thaliana clone P2WB1-E05-970 unknown protein gene, exons
            41 through 43 and partial cds
          Length = 1482

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1206 atcatcatcatcttcttcttct 1227
            ||||||||||||||||||||||
Sbjct: 965  atcatcatcatcttcttcttct 944
>gb|AY140491.1| Arabidopsis thaliana clone P2WB1-E05-1006 unknown protein gene, exons
            41 through 43 and partial cds
          Length = 1482

 Score = 44.1 bits (22), Expect = 0.060
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1206 atcatcatcatcttcttcttct 1227
            ||||||||||||||||||||||
Sbjct: 965  atcatcatcatcttcttcttct 944
  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 807,123
Number of Sequences: 1013581
Number of extensions: 807123
Number of successful extensions: 88661
Number of sequences better than  0.5: 180
Number of HSP's better than  0.5 without gapping: 194
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79290
Number of HSP's gapped (non-prelim): 9330
length of query: 1293
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1273
effective length of database: 888,669,252
effective search space: 1131275957796
effective search space used: 1131275957796
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)